Incidental Mutation 'R2372:Sh3bp2'
ID 248160
Institutional Source Beutler Lab
Gene Symbol Sh3bp2
Ensembl Gene ENSMUSG00000054520
Gene Name SH3-domain binding protein 2
Synonyms 3BP2
MMRRC Submission 040352-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2372 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 34683182-34720985 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34716840 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 361 (I361T)
Ref Sequence ENSEMBL: ENSMUSP00000136671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067638] [ENSMUST00000101316] [ENSMUST00000118545] [ENSMUST00000179943]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067638
AA Change: I361T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070890
Gene: ENSMUSG00000054520
AA Change: I361T

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101316
AA Change: I405T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098874
Gene: ENSMUSG00000054520
AA Change: I405T

DomainStartEndE-ValueType
PH 71 176 1.33e-18 SMART
low complexity region 185 195 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 244 260 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
low complexity region 414 429 N/A INTRINSIC
SH2 497 586 2.04e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118545
AA Change: I417T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112554
Gene: ENSMUSG00000054520
AA Change: I417T

DomainStartEndE-ValueType
PH 83 188 1.33e-18 SMART
low complexity region 197 207 N/A INTRINSIC
low complexity region 226 241 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
SH2 509 598 2.04e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153750
Predicted Effect probably benign
Transcript: ENSMUST00000179943
AA Change: I361T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136671
Gene: ENSMUSG00000054520
AA Change: I361T

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has an N-terminal pleckstrin homology (PH) domain, an SH3-binding proline-rich region, and a C-terminal SH2 domain. The protein binds to the SH3 domains of several proteins including the ABL1 and SYK protein tyrosine kinases , and functions as a cytoplasmic adaptor protein to positively regulate transcriptional activity in T, natural killer (NK), and basophilic cells. Mutations in this gene result in cherubism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Nullizygous mutations may lead to higher pre-B cell numbers and impaired B cell receptor signaling or thymus-independent type 2 humoral responses. Homozygosity for a knock-in allele causes premature death, enhanced osteoclast differentiation and TNF production, systemic bone loss and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,009,704 (GRCm39) L135S probably damaging Het
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Alpi G T 1: 87,028,316 (GRCm39) T169N probably damaging Het
Ccdc15 T C 9: 37,226,801 (GRCm39) D378G possibly damaging Het
Cpb2 T G 14: 75,505,490 (GRCm39) V162G probably damaging Het
Dnmbp T C 19: 43,890,759 (GRCm39) E336G probably benign Het
Dok6 G C 18: 89,432,988 (GRCm39) R274G probably null Het
Eef1d G A 15: 75,768,166 (GRCm39) R199C probably damaging Het
Epha8 T C 4: 136,660,321 (GRCm39) Y714C probably damaging Het
Fyb1 T C 15: 6,681,388 (GRCm39) probably benign Het
Gfpt2 A G 11: 49,698,542 (GRCm39) N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably benign Het
Gm11596 C A 11: 99,684,082 (GRCm39) E13* probably null Het
Gsx2 T C 5: 75,237,713 (GRCm39) F222L probably damaging Het
Hpca T A 4: 129,012,237 (GRCm39) K100* probably null Het
Iqsec1 A G 6: 90,671,636 (GRCm39) S89P probably damaging Het
Kif12 T A 4: 63,086,796 (GRCm39) T347S possibly damaging Het
Knop1 A G 7: 118,452,440 (GRCm39) L93S probably damaging Het
Mib1 A G 18: 10,812,045 (GRCm39) T981A probably damaging Het
N4bp2l1 C T 5: 150,496,246 (GRCm39) E123K probably damaging Het
Npr2 C T 4: 43,650,432 (GRCm39) R976W probably damaging Het
Rbpj T C 5: 53,799,537 (GRCm39) probably benign Het
Ro60 C A 1: 143,646,620 (GRCm39) E42* probably null Het
Ruvbl1 T C 6: 88,462,779 (GRCm39) V301A possibly damaging Het
Sgip1 T C 4: 102,766,988 (GRCm39) probably null Het
Skint1 T A 4: 111,876,348 (GRCm39) Y90N probably damaging Het
Slc25a45 G A 19: 5,934,580 (GRCm39) V183I probably benign Het
Slco4c1 T A 1: 96,748,925 (GRCm39) H664L probably benign Het
Sult2a4 T A 7: 13,649,225 (GRCm39) I194L probably benign Het
Tecta C A 9: 42,299,570 (GRCm39) D173Y probably damaging Het
Tnrc18 T A 5: 142,745,459 (GRCm39) probably benign Het
Use1 T C 8: 71,821,823 (GRCm39) L169P possibly damaging Het
Zfp335 A G 2: 164,736,959 (GRCm39) L918P probably damaging Het
Zfp451 A T 1: 33,819,133 (GRCm39) probably null Het
Other mutations in Sh3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Sh3bp2 APN 5 34,713,347 (GRCm39) missense probably damaging 0.99
IGL02478:Sh3bp2 APN 5 34,709,006 (GRCm39) missense probably damaging 1.00
IGL03196:Sh3bp2 APN 5 34,714,687 (GRCm39) missense probably damaging 1.00
IGL03329:Sh3bp2 APN 5 34,716,546 (GRCm39) missense probably benign 0.00
R0718:Sh3bp2 UTSW 5 34,712,839 (GRCm39) missense probably damaging 0.99
R1322:Sh3bp2 UTSW 5 34,712,837 (GRCm39) missense probably damaging 1.00
R1501:Sh3bp2 UTSW 5 34,712,920 (GRCm39) critical splice donor site probably null
R1573:Sh3bp2 UTSW 5 34,718,034 (GRCm39) missense probably benign 0.01
R1649:Sh3bp2 UTSW 5 34,716,348 (GRCm39) missense possibly damaging 0.61
R1939:Sh3bp2 UTSW 5 34,708,963 (GRCm39) missense probably damaging 1.00
R2021:Sh3bp2 UTSW 5 34,701,569 (GRCm39) critical splice acceptor site probably benign
R2903:Sh3bp2 UTSW 5 34,700,900 (GRCm39) nonsense probably null
R3709:Sh3bp2 UTSW 5 34,709,002 (GRCm39) missense probably damaging 1.00
R4344:Sh3bp2 UTSW 5 34,712,886 (GRCm39) missense possibly damaging 0.86
R4391:Sh3bp2 UTSW 5 34,707,062 (GRCm39) missense probably benign
R5068:Sh3bp2 UTSW 5 34,714,311 (GRCm39) missense probably benign 0.00
R5637:Sh3bp2 UTSW 5 34,718,392 (GRCm39) missense possibly damaging 0.69
R5658:Sh3bp2 UTSW 5 34,714,291 (GRCm39) missense probably damaging 1.00
R6005:Sh3bp2 UTSW 5 34,719,809 (GRCm39) missense possibly damaging 0.65
R6014:Sh3bp2 UTSW 5 34,716,971 (GRCm39) missense probably benign 0.00
R6391:Sh3bp2 UTSW 5 34,718,947 (GRCm39) missense probably damaging 1.00
R6737:Sh3bp2 UTSW 5 34,719,818 (GRCm39) missense probably damaging 1.00
R7144:Sh3bp2 UTSW 5 34,718,975 (GRCm39) missense probably benign 0.00
R7536:Sh3bp2 UTSW 5 34,700,901 (GRCm39) missense probably benign
R7871:Sh3bp2 UTSW 5 34,716,429 (GRCm39) missense not run
R8775:Sh3bp2 UTSW 5 34,719,751 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Sh3bp2 UTSW 5 34,719,751 (GRCm39) missense probably damaging 1.00
R9052:Sh3bp2 UTSW 5 34,709,164 (GRCm39) intron probably benign
R9180:Sh3bp2 UTSW 5 34,718,377 (GRCm39) nonsense probably null
R9350:Sh3bp2 UTSW 5 34,718,453 (GRCm39) critical splice donor site probably null
R9687:Sh3bp2 UTSW 5 34,716,977 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCCGGGACAGTGTGAATCC -3'
(R):5'- TGAAGGAACCTATTGACTGGC -3'

Sequencing Primer
(F):5'- AGTGTGAATCCCGGCCTAGAAC -3'
(R):5'- ACCTATTGACTGGCAGGCAG -3'
Posted On 2014-11-11