Incidental Mutation 'R2372:Rbpj'
ID248161
Institutional Source Beutler Lab
Gene Symbol Rbpj
Ensembl Gene ENSMUSG00000039191
Gene Namerecombination signal binding protein for immunoglobulin kappa J region
SynonymsRBP-J kappa, CBF1, Igkjrb, RBPjk, Igkrsbp, Rbpsuh
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53466152-53657362 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 53642195 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037618] [ENSMUST00000087360] [ENSMUST00000113865] [ENSMUST00000201883] [ENSMUST00000201912] [ENSMUST00000201991]
Predicted Effect probably benign
Transcript: ENSMUST00000037618
SMART Domains Protein: ENSMUSP00000040694
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 73 204 2.97e-86 SMART
BTD 205 354 8.01e-92 SMART
SCOP:d1a02n1 380 472 8e-29 SMART
low complexity region 508 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087360
SMART Domains Protein: ENSMUSP00000084618
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 32 163 2.97e-86 SMART
BTD 164 313 8.01e-92 SMART
Pfam:TIG 340 429 3.6e-9 PFAM
low complexity region 467 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113865
SMART Domains Protein: ENSMUSP00000109496
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 34 165 2.97e-86 SMART
BTD 166 315 8.01e-92 SMART
Pfam:TIG 342 431 6.1e-9 PFAM
low complexity region 469 487 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201701
Predicted Effect probably benign
Transcript: ENSMUST00000201883
SMART Domains Protein: ENSMUSP00000143846
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 12 143 2.3e-90 SMART
BTD 144 293 6e-96 SMART
SCOP:d1a02n1 319 411 4e-29 SMART
low complexity region 447 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201912
SMART Domains Protein: ENSMUSP00000143866
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 54 185 2.97e-86 SMART
BTD 186 335 8.01e-92 SMART
SCOP:d1a02n1 361 453 6e-29 SMART
low complexity region 489 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201928
Predicted Effect probably benign
Transcript: ENSMUST00000201991
SMART Domains Protein: ENSMUSP00000144617
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 42 173 2.3e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202476
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator important in the Notch signaling pathway. The encoded protein acts as a repressor when not bound to Notch proteins and an activator when bound to Notch proteins. It is thought to function by recruiting chromatin remodeling complexes containing histone deacetylase or histone acetylase proteins to Notch signaling pathway genes. Several transcript variants encoding different isoforms have been found for this gene, and several pseudogenes of this gene exist on chromosome 9. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Rbpj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Rbpj APN 5 53651386 missense probably damaging 1.00
IGL02537:Rbpj APN 5 53642143 missense probably damaging 1.00
R0676:Rbpj UTSW 5 53646048 splice site probably benign
R3814:Rbpj UTSW 5 53653172 nonsense probably null
R4153:Rbpj UTSW 5 53649447 missense probably damaging 1.00
R5023:Rbpj UTSW 5 53649415 missense probably damaging 1.00
R5240:Rbpj UTSW 5 53649440 missense probably damaging 1.00
R5341:Rbpj UTSW 5 53642083 missense possibly damaging 0.71
R6088:Rbpj UTSW 5 53651368 unclassified probably null
R6885:Rbpj UTSW 5 53653151 missense probably damaging 1.00
R7493:Rbpj UTSW 5 53600934 missense probably benign 0.19
R7653:Rbpj UTSW 5 53590351 start codon destroyed probably null
R7703:Rbpj UTSW 5 53645898 missense probably damaging 1.00
R7893:Rbpj UTSW 5 53645874 missense probably damaging 1.00
R8076:Rbpj UTSW 5 53642137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTATGTTAGGGACCAATTTAG -3'
(R):5'- ATGCTACCCCGCACACTATG -3'

Sequencing Primer
(F):5'- TGTTAGGGACCAATTTAGTACATTG -3'
(R):5'- GCACACTATGAGCCAGCAGG -3'
Posted On2014-11-11