Incidental Mutation 'R2372:Gsx2'
ID248162
Institutional Source Beutler Lab
Gene Symbol Gsx2
Ensembl Gene ENSMUSG00000035946
Gene NameGS homeobox 2
SynonymsGsh-2, Gsh2
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location75075601-75077893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75077052 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 222 (F222L)
Ref Sequence ENSEMBL: ENSMUSP00000036625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040477] [ENSMUST00000160104]
Predicted Effect probably damaging
Transcript: ENSMUST00000040477
AA Change: F222L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036625
Gene: ENSMUSG00000035946
AA Change: F222L

DomainStartEndE-ValueType
low complexity region 76 101 N/A INTRINSIC
low complexity region 124 172 N/A INTRINSIC
HOX 203 265 9.33e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160104
SMART Domains Protein: ENSMUSP00000123712
Gene: ENSMUSG00000035946

DomainStartEndE-ValueType
low complexity region 76 101 N/A INTRINSIC
Meta Mutation Damage Score 0.9627 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation die within 24 hrs after birth, displaying an early misspecification of precursors in the lateral ganglionic eminence that leads to disruptions in striatal and olfactory bulb development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Gsx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Gsx2 APN 5 75075791 missense probably damaging 1.00
R0018:Gsx2 UTSW 5 75077167 missense probably damaging 1.00
R0018:Gsx2 UTSW 5 75077167 missense probably damaging 1.00
R0265:Gsx2 UTSW 5 75077068 missense probably damaging 1.00
R0496:Gsx2 UTSW 5 75077065 missense probably benign 0.26
R1017:Gsx2 UTSW 5 75077262 missense probably damaging 1.00
R7226:Gsx2 UTSW 5 75075960 nonsense probably null
R7362:Gsx2 UTSW 5 75076104 missense possibly damaging 0.92
R7504:Gsx2 UTSW 5 75076399 intron probably null
R8153:Gsx2 UTSW 5 75077055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTTTCCAAGGGTTGTCAAG -3'
(R):5'- GGGGAAATCTCCTTGTCTTCG -3'

Sequencing Primer
(F):5'- CTTTCCAAGGGTTGTCAAGTAGAG -3'
(R):5'- ATAATGCGCCTGGCTACC -3'
Posted On2014-11-11