Incidental Mutation 'R2372:N4bp2l1'
ID248164
Institutional Source Beutler Lab
Gene Symbol N4bp2l1
Ensembl Gene ENSMUSG00000041132
Gene NameNEDD4 binding protein 2-like 1
Synonyms
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150571644-150597188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 150572781 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 123 (E123K)
Ref Sequence ENSEMBL: ENSMUSP00000144164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016279] [ENSMUST00000044620] [ENSMUST00000202031] [ENSMUST00000202279] [ENSMUST00000202291] [ENSMUST00000202313]
Predicted Effect probably benign
Transcript: ENSMUST00000016279
AA Change: E227K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000016279
Gene: ENSMUSG00000041132
AA Change: E227K

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:AAA_33 42 176 6.1e-19 PFAM
Pfam:AAA_17 42 198 3.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044620
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201309
Predicted Effect probably damaging
Transcript: ENSMUST00000202031
AA Change: E123K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144164
Gene: ENSMUSG00000041132
AA Change: E123K

DomainStartEndE-ValueType
SCOP:d1ly1a_ 8 71 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202279
SMART Domains Protein: ENSMUSP00000143792
Gene: ENSMUSG00000041132

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
SCOP:d1l4ua_ 42 58 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202291
Predicted Effect probably benign
Transcript: ENSMUST00000202313
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Meta Mutation Damage Score 0.1910 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in N4bp2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01737:N4bp2l1 APN 5 150594316 missense possibly damaging 0.46
IGL02048:N4bp2l1 APN 5 150576638 critical splice donor site probably null
R0625:N4bp2l1 UTSW 5 150576745 nonsense probably null
R0763:N4bp2l1 UTSW 5 150594404 missense possibly damaging 0.66
R5548:N4bp2l1 UTSW 5 150572955 nonsense probably null
R7311:N4bp2l1 UTSW 5 150572924 missense probably damaging 1.00
R7414:N4bp2l1 UTSW 5 150576293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACGTCACTTGTTGGAG -3'
(R):5'- AAGAAACATCCATGGGGTCC -3'

Sequencing Primer
(F):5'- GAATGACCTCTGTTCAGAAACTTC -3'
(R):5'- AATACAACGAATGAAAGAACGGTATG -3'
Posted On2014-11-11