Incidental Mutation 'R2372:Iqsec1'
ID248166
Institutional Source Beutler Lab
Gene Symbol Iqsec1
Ensembl Gene ENSMUSG00000034312
Gene NameIQ motif and Sec7 domain 1
SynonymsD6Ertd349e, cI-43, BRAG2
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R2372 (G1)
Quality Score209
Status Validated
Chromosome6
Chromosomal Location90656088-90988685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90694654 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000118802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101151] [ENSMUST00000101153] [ENSMUST00000156834] [ENSMUST00000212100]
Predicted Effect probably damaging
Transcript: ENSMUST00000101151
AA Change: S74P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098710
Gene: ENSMUSG00000034312
AA Change: S74P

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
Blast:Sec7 69 369 6e-39 BLAST
low complexity region 370 389 N/A INTRINSIC
low complexity region 396 430 N/A INTRINSIC
low complexity region 450 481 N/A INTRINSIC
Sec7 505 696 1.31e-95 SMART
PH 737 848 2.39e-2 SMART
low complexity region 901 914 N/A INTRINSIC
low complexity region 963 976 N/A INTRINSIC
low complexity region 978 1000 N/A INTRINSIC
low complexity region 1014 1060 N/A INTRINSIC
low complexity region 1062 1094 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101153
AA Change: S88P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098712
Gene: ENSMUSG00000034312
AA Change: S88P

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:Sec7 83 383 4e-39 BLAST
low complexity region 384 403 N/A INTRINSIC
low complexity region 410 444 N/A INTRINSIC
low complexity region 464 495 N/A INTRINSIC
Sec7 519 710 1.31e-95 SMART
PH 751 862 2.39e-2 SMART
low complexity region 915 928 N/A INTRINSIC
low complexity region 948 957 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146977
Predicted Effect probably damaging
Transcript: ENSMUST00000156834
AA Change: S89P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118802
Gene: ENSMUSG00000034312
AA Change: S89P

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
Blast:Sec7 84 208 5e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205068
Predicted Effect probably damaging
Transcript: ENSMUST00000212100
AA Change: S178P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in neurons fail to exhibit mGluR- and NMDAR-mediated long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Iqsec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Iqsec1 APN 6 90689703 missense probably damaging 1.00
IGL01749:Iqsec1 APN 6 90680504 missense probably benign 0.03
IGL01960:Iqsec1 APN 6 90676780 missense probably damaging 1.00
IGL02007:Iqsec1 APN 6 90690349 missense probably benign 0.37
IGL02045:Iqsec1 APN 6 90664069 missense probably damaging 0.96
IGL02186:Iqsec1 APN 6 90676877 missense probably damaging 1.00
IGL02211:Iqsec1 APN 6 90671609 missense probably damaging 1.00
IGL02503:Iqsec1 APN 6 90668788 missense probably damaging 1.00
IGL02506:Iqsec1 APN 6 90672075 missense possibly damaging 0.94
IGL02554:Iqsec1 APN 6 90669345 missense probably damaging 1.00
PIT4260001:Iqsec1 UTSW 6 90690489 missense probably damaging 1.00
PIT4810001:Iqsec1 UTSW 6 90670491 missense probably damaging 1.00
R0139:Iqsec1 UTSW 6 90809758 intron probably benign
R0371:Iqsec1 UTSW 6 90670403 splice site probably benign
R0617:Iqsec1 UTSW 6 90689970 missense probably damaging 1.00
R0619:Iqsec1 UTSW 6 90670406 splice site probably null
R1157:Iqsec1 UTSW 6 90669384 missense possibly damaging 0.83
R1168:Iqsec1 UTSW 6 90689676 missense probably damaging 1.00
R1190:Iqsec1 UTSW 6 90689677 missense probably damaging 1.00
R1192:Iqsec1 UTSW 6 90671976 splice site probably benign
R1435:Iqsec1 UTSW 6 90672024 missense probably damaging 1.00
R1449:Iqsec1 UTSW 6 90690808 nonsense probably null
R1697:Iqsec1 UTSW 6 90809770 nonsense probably null
R1921:Iqsec1 UTSW 6 90662895 missense probably benign 0.00
R1958:Iqsec1 UTSW 6 90670459 missense probably damaging 1.00
R2017:Iqsec1 UTSW 6 90689930 missense probably benign 0.02
R2082:Iqsec1 UTSW 6 90694574 missense probably damaging 1.00
R2442:Iqsec1 UTSW 6 90689883 missense possibly damaging 0.52
R4120:Iqsec1 UTSW 6 90662602 nonsense probably null
R4371:Iqsec1 UTSW 6 90694606 missense probably damaging 1.00
R4645:Iqsec1 UTSW 6 90668013 missense probably damaging 1.00
R4864:Iqsec1 UTSW 6 90664056 missense probably damaging 1.00
R5436:Iqsec1 UTSW 6 90845361 intron probably benign
R5790:Iqsec1 UTSW 6 90689880 nonsense probably null
R6007:Iqsec1 UTSW 6 90660987 nonsense probably null
R6143:Iqsec1 UTSW 6 90809684 intron probably null
R6218:Iqsec1 UTSW 6 90689635 missense probably damaging 1.00
R6972:Iqsec1 UTSW 6 90676768 missense probably damaging 1.00
R7506:Iqsec1 UTSW 6 90662806 missense possibly damaging 0.53
R7506:Iqsec1 UTSW 6 90667909 missense probably damaging 1.00
R7539:Iqsec1 UTSW 6 90662891 missense probably benign 0.00
R8238:Iqsec1 UTSW 6 90689930 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGTATCTGGAACCCATCACC -3'
(R):5'- TCTCCTCTGCAGTGTTGAGG -3'

Sequencing Primer
(F):5'- CCAAGAACATCAGGCAGCTG -3'
(R):5'- CAGTGTTGAGGGCGAGGC -3'
Posted On2014-11-11