Incidental Mutation 'R2372:Sult2a4'
ID248168
Institutional Source Beutler Lab
Gene Symbol Sult2a4
Ensembl Gene ENSMUSG00000074377
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4
SynonymsGm5584
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13909676-13989607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13915300 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 194 (I194L)
Ref Sequence ENSEMBL: ENSMUSP00000130490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108520] [ENSMUST00000165167]
Predicted Effect probably benign
Transcript: ENSMUST00000108520
AA Change: I195L

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104160
Gene: ENSMUSG00000074377
AA Change: I195L

DomainStartEndE-ValueType
Pfam:Sulfotransfer_3 5 205 1.5e-10 PFAM
Pfam:Sulfotransfer_1 34 278 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165167
AA Change: I194L

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130490
Gene: ENSMUSG00000074377
AA Change: I194L

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 33 277 1.3e-82 PFAM
Meta Mutation Damage Score 0.2094 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Sult2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Sult2a4 APN 7 13984945 missense probably damaging 1.00
IGL00835:Sult2a4 APN 7 13909789 missense probably benign 0.01
IGL02078:Sult2a4 APN 7 13989544 missense probably benign 0.02
IGL02409:Sult2a4 APN 7 13984919 nonsense probably null
IGL02970:Sult2a4 APN 7 13909906 splice site probably benign
IGL03201:Sult2a4 APN 7 13931767 missense probably damaging 0.97
R0827:Sult2a4 UTSW 7 13984961 missense probably benign 0.03
R1484:Sult2a4 UTSW 7 13909801 missense probably benign
R1523:Sult2a4 UTSW 7 13909860 nonsense probably null
R1613:Sult2a4 UTSW 7 13989495 missense probably damaging 0.98
R2127:Sult2a4 UTSW 7 13915260 missense probably damaging 0.99
R3161:Sult2a4 UTSW 7 13989471 missense probably benign 0.17
R5181:Sult2a4 UTSW 7 13988391 missense probably benign 0.04
R7124:Sult2a4 UTSW 7 13988395 nonsense probably null
R8214:Sult2a4 UTSW 7 13989476 missense probably benign 0.10
X0028:Sult2a4 UTSW 7 13988241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACTACTTAGAGCTTCATTGGCAC -3'
(R):5'- TGAGTGTGAGTCCTTTCCGC -3'

Sequencing Primer
(F):5'- GGCACAACAAGCCCTTCACTTG -3'
(R):5'- GTGTGAGTCCTTTCCGCCTTTG -3'
Posted On2014-11-11