Incidental Mutation 'R2372:Knop1'
ID248170
Institutional Source Beutler Lab
Gene Symbol Knop1
Ensembl Gene ENSMUSG00000030980
Gene Namelysine rich nucleolar protein 1
SynonymsTsg118, 2310008H09Rik
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118842222-118856254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118853217 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 93 (L93S)
Ref Sequence ENSEMBL: ENSMUSP00000111984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063607] [ENSMUST00000098087] [ENSMUST00000106547] [ENSMUST00000106549] [ENSMUST00000106550] [ENSMUST00000116280] [ENSMUST00000126792] [ENSMUST00000152136] [ENSMUST00000152309] [ENSMUST00000208658]
Predicted Effect probably benign
Transcript: ENSMUST00000033277
SMART Domains Protein: ENSMUSP00000033277
Gene: ENSMUSG00000030980

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
internal_repeat_1 401 413 1.29e-7 PROSPERO
internal_repeat_1 417 429 1.29e-7 PROSPERO
Pfam:SMAP 435 509 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063607
AA Change: L93S

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068142
Gene: ENSMUSG00000030980
AA Change: L93S

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
internal_repeat_1 239 251 6.9e-7 PROSPERO
internal_repeat_1 255 267 6.9e-7 PROSPERO
Pfam:SMAP 273 347 3.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098087
SMART Domains Protein: ENSMUSP00000095693
Gene: ENSMUSG00000073856

DomainStartEndE-ValueType
low complexity region 111 120 N/A INTRINSIC
IQ 219 241 7.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106547
SMART Domains Protein: ENSMUSP00000102157
Gene: ENSMUSG00000073856

DomainStartEndE-ValueType
low complexity region 108 117 N/A INTRINSIC
IQ 216 238 7.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106549
AA Change: L41S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102159
Gene: ENSMUSG00000030980
AA Change: L41S

DomainStartEndE-ValueType
low complexity region 71 83 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
internal_repeat_1 187 199 1.42e-6 PROSPERO
internal_repeat_1 203 215 1.42e-6 PROSPERO
Pfam:SMAP 221 295 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106550
AA Change: L93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102160
Gene: ENSMUSG00000030980
AA Change: L93S

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
internal_repeat_1 216 228 4.11e-7 PROSPERO
internal_repeat_1 232 244 4.11e-7 PROSPERO
Pfam:SMAP 250 324 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116280
AA Change: L93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111984
Gene: ENSMUSG00000030980
AA Change: L93S

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
internal_repeat_1 401 413 1.29e-7 PROSPERO
internal_repeat_1 417 429 1.29e-7 PROSPERO
Pfam:SMAP 436 509 7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126792
AA Change: L93S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114727
Gene: ENSMUSG00000030980
AA Change: L93S

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
internal_repeat_1 216 228 4.11e-7 PROSPERO
internal_repeat_1 232 244 4.11e-7 PROSPERO
Pfam:SMAP 251 324 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152136
Predicted Effect probably damaging
Transcript: ENSMUST00000152309
AA Change: L41S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117151
Gene: ENSMUSG00000030980
AA Change: L41S

DomainStartEndE-ValueType
low complexity region 71 83 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153518
Predicted Effect probably benign
Transcript: ENSMUST00000208658
Meta Mutation Damage Score 0.4381 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleolar protein that interacts with zinc finger 106 protein. The encoded protein has several of the same characteristics as nucleostemin and may be involved in testis development. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Knop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Knop1 APN 7 118852644 missense probably benign 0.09
IGL00840:Knop1 APN 7 118852798 missense probably damaging 0.96
IGL01484:Knop1 APN 7 118852809 missense probably damaging 0.99
IGL01608:Knop1 APN 7 118845796 missense probably benign 0.30
IGL03094:Knop1 APN 7 118853151 missense possibly damaging 0.92
R0147:Knop1 UTSW 7 118845838 missense probably benign 0.35
R0403:Knop1 UTSW 7 118853053 missense probably damaging 0.99
R0421:Knop1 UTSW 7 118855629 missense possibly damaging 0.53
R1483:Knop1 UTSW 7 118853050 missense probably damaging 0.96
R1513:Knop1 UTSW 7 118852449 unclassified probably benign
R1541:Knop1 UTSW 7 118855786 unclassified probably benign
R2366:Knop1 UTSW 7 118852528 missense possibly damaging 0.60
R2872:Knop1 UTSW 7 118855963 critical splice donor site probably null
R3001:Knop1 UTSW 7 118852449 unclassified probably benign
R3002:Knop1 UTSW 7 118852449 unclassified probably benign
R4723:Knop1 UTSW 7 118855864 unclassified probably benign
R4916:Knop1 UTSW 7 118846076 missense probably damaging 1.00
R5286:Knop1 UTSW 7 118855770 missense probably damaging 0.99
R5326:Knop1 UTSW 7 118853272 missense possibly damaging 0.91
R5733:Knop1 UTSW 7 118846082 missense probably damaging 0.96
R5950:Knop1 UTSW 7 118853334 missense probably damaging 1.00
R6741:Knop1 UTSW 7 118845838 missense possibly damaging 0.79
R7654:Knop1 UTSW 7 118845809 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTGCTGACTGCTCAAGGG -3'
(R):5'- CAAGGAATGGGAGCTGTTTCC -3'

Sequencing Primer
(F):5'- TCAAGGGCCTGCCTTCTAG -3'
(R):5'- CTTTCTCTCGGACCGCAG -3'
Posted On2014-11-11