Incidental Mutation 'R2372:Use1'
ID248172
Institutional Source Beutler Lab
Gene Symbol Use1
Ensembl Gene ENSMUSG00000002395
Gene Nameunconventional SNARE in the ER 1 homolog (S. cerevisiae)
Synonyms5730403H22Rik, mED2, Q-SNARE, D12, 2010315L10Rik
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71366848-71369732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71369179 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 169 (L169P)
Ref Sequence ENSEMBL: ENSMUSP00000105681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002466] [ENSMUST00000002469] [ENSMUST00000019169] [ENSMUST00000110051] [ENSMUST00000110052] [ENSMUST00000110053] [ENSMUST00000110054] [ENSMUST00000139541]
Predicted Effect probably benign
Transcript: ENSMUST00000002466
SMART Domains Protein: ENSMUSP00000002466
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
ZnF_C4 54 125 1.48e-38 SMART
low complexity region 173 185 N/A INTRINSIC
HOLI 191 351 1.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000002469
SMART Domains Protein: ENSMUSP00000002469
Gene: ENSMUSG00000002396

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
low complexity region 29 62 N/A INTRINSIC
Pfam:Occludin_ELL 106 207 8.7e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000019169
AA Change: L169P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019169
Gene: ENSMUSG00000002395
AA Change: L169P

DomainStartEndE-ValueType
Pfam:Use1 15 266 9.7e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110051
SMART Domains Protein: ENSMUSP00000105678
Gene: ENSMUSG00000002396

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
low complexity region 29 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110052
SMART Domains Protein: ENSMUSP00000105679
Gene: ENSMUSG00000002396

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
low complexity region 29 62 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110053
AA Change: L183P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105680
Gene: ENSMUSG00000002395
AA Change: L183P

DomainStartEndE-ValueType
Pfam:Use1 30 280 4.6e-95 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110054
AA Change: L169P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105681
Gene: ENSMUSG00000002395
AA Change: L169P

DomainStartEndE-ValueType
Pfam:Use1 15 266 9.7e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137137
Predicted Effect probably benign
Transcript: ENSMUST00000139541
SMART Domains Protein: ENSMUSP00000122406
Gene: ENSMUSG00000002395

DomainStartEndE-ValueType
Pfam:Use1 15 74 2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154550
Meta Mutation Damage Score 0.9074 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in complete embryonic lethality prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Use1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Use1 APN 8 71367067 utr 5 prime probably benign
R0442:Use1 UTSW 8 71367058 utr 5 prime probably benign
R0690:Use1 UTSW 8 71367065 utr 5 prime probably benign
R4763:Use1 UTSW 8 71367308 missense probably damaging 1.00
R5643:Use1 UTSW 8 71367754 intron probably benign
R5705:Use1 UTSW 8 71369687 missense probably damaging 1.00
R5908:Use1 UTSW 8 71369613 missense probably damaging 1.00
R6783:Use1 UTSW 8 71369236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTATAAGGACCAGCTGCC -3'
(R):5'- CAGAGCTTTCTGAGGCAGAC -3'

Sequencing Primer
(F):5'- CTGCTGTTCCCAGAATGTAAAAGAGC -3'
(R):5'- CTTTCTGAGGCAGACAGAGGC -3'
Posted On2014-11-11