Incidental Mutation 'R2372:Ccdc15'
ID248173
Institutional Source Beutler Lab
Gene Symbol Ccdc15
Ensembl Gene ENSMUSG00000034303
Gene Namecoiled-coil domain containing 15
SynonymsA630039F14Rik
MMRRC Submission 040352-MU
Accession Numbers

Genbank: NM_001081429; MGI: 2444488

Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37275835-37348432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37315505 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 378 (D378G)
Ref Sequence ENSEMBL: ENSMUSP00000150207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037275] [ENSMUST00000213633] [ENSMUST00000215116]
Predicted Effect probably benign
Transcript: ENSMUST00000037275
AA Change: D391G

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000036784
Gene: ENSMUSG00000034303
AA Change: D391G

DomainStartEndE-ValueType
low complexity region 80 92 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
coiled coil region 173 202 N/A INTRINSIC
coiled coil region 652 686 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000213633
AA Change: D378G

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000215116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217440
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Ccdc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Ccdc15 APN 9 37320473 missense probably damaging 1.00
IGL00823:Ccdc15 APN 9 37320413 missense probably benign 0.01
IGL00979:Ccdc15 APN 9 37316490 missense probably benign 0.44
IGL01380:Ccdc15 APN 9 37276557 utr 3 prime probably benign
IGL01832:Ccdc15 APN 9 37311344 missense probably damaging 0.97
IGL01845:Ccdc15 APN 9 37315236 nonsense probably null
IGL02375:Ccdc15 APN 9 37304332 missense probably damaging 0.99
F6893:Ccdc15 UTSW 9 37315640 missense probably damaging 0.97
FR4304:Ccdc15 UTSW 9 37315157 frame shift probably null
FR4449:Ccdc15 UTSW 9 37315158 frame shift probably null
R1743:Ccdc15 UTSW 9 37277477 nonsense probably null
R1848:Ccdc15 UTSW 9 37342570 missense probably benign 0.00
R1968:Ccdc15 UTSW 9 37347795 missense probably benign 0.05
R2006:Ccdc15 UTSW 9 37315472 missense possibly damaging 0.91
R2932:Ccdc15 UTSW 9 37315658 missense probably benign 0.00
R3962:Ccdc15 UTSW 9 37320486 missense probably damaging 1.00
R5585:Ccdc15 UTSW 9 37277403 missense probably benign 0.00
R5919:Ccdc15 UTSW 9 37320396 critical splice donor site probably null
R6000:Ccdc15 UTSW 9 37315764 missense probably benign 0.00
R6198:Ccdc15 UTSW 9 37314285 critical splice donor site probably null
R6476:Ccdc15 UTSW 9 37342419 missense probably benign 0.04
R7098:Ccdc15 UTSW 9 37343960 missense probably damaging 1.00
R7485:Ccdc15 UTSW 9 37315278 missense probably benign
R7548:Ccdc15 UTSW 9 37277427 missense probably benign 0.45
R7627:Ccdc15 UTSW 9 37342402 missense unknown
R7807:Ccdc15 UTSW 9 37315382 missense probably benign 0.07
R8157:Ccdc15 UTSW 9 37315457 missense probably benign
R8230:Ccdc15 UTSW 9 37315259 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGAAACTGTTCTCTAGGTAG -3'
(R):5'- CTAGGTGTTGAGCCAGACAC -3'

Sequencing Primer
(F):5'- GAAACTGTTCTCTAGGTAGGAGATCC -3'
(R):5'- TGTTGAGCCAGACACCCAGG -3'
Posted On2014-11-11