Incidental Mutation 'R2372:Gm10608'
ID248176
Institutional Source Beutler Lab
Gene Symbol Gm10608
Ensembl Gene ENSMUSG00000074029
Gene Namepredicted gene 10608
SynonymsEG546165
MMRRC Submission 040352-MU
Accession Numbers

Genbank: XR_031269; Ensembl: ENSMUST00000093527; MGI: 3642009

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2372 (G1)
Quality Score145
Status Validated
Chromosome9
Chromosomal Location119162652-119164087 bp(+) (GRCm38)
Type of Mutationsmall deletion (4 aa in frame mutation)
DNA Base Change (assembly) CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA at 119160716 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010795] [ENSMUST00000093527]
Predicted Effect probably benign
Transcript: ENSMUST00000010795
SMART Domains Protein: ENSMUSP00000010795
Gene: ENSMUSG00000010651

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 6.7e-90 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093527
SMART Domains Protein: ENSMUSP00000091246
Gene: ENSMUSG00000074029

DomainStartEndE-ValueType
Pfam:DUF3915 11 80 3.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213924
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Gm10608
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Gm10608 UTSW 9 119161088 unclassified probably benign
R1023:Gm10608 UTSW 9 119160716 small deletion probably benign
R1053:Gm10608 UTSW 9 119160716 frame shift probably null
R1148:Gm10608 UTSW 9 119160716 frame shift probably null
R1148:Gm10608 UTSW 9 119160716 frame shift probably null
R1167:Gm10608 UTSW 9 119160716 frame shift probably null
R1172:Gm10608 UTSW 9 119160716 frame shift probably null
R1211:Gm10608 UTSW 9 119160712 frame shift probably null
R1601:Gm10608 UTSW 9 119160716 frame shift probably null
R1743:Gm10608 UTSW 9 119160716 small deletion probably benign
R1766:Gm10608 UTSW 9 119160716 frame shift probably null
R1939:Gm10608 UTSW 9 119160716 frame shift probably null
R2016:Gm10608 UTSW 9 119160716 small deletion probably benign
R2127:Gm10608 UTSW 9 119160716 small deletion probably benign
R2217:Gm10608 UTSW 9 119160716 frame shift probably null
R2270:Gm10608 UTSW 9 119160716 frame shift probably null
R2844:Gm10608 UTSW 9 119160716 frame shift probably null
R2959:Gm10608 UTSW 9 119160716 frame shift probably null
R2968:Gm10608 UTSW 9 119160716 small deletion probably benign
R3084:Gm10608 UTSW 9 119160716 frame shift probably null
R3607:Gm10608 UTSW 9 119160716 small deletion probably benign
R3702:Gm10608 UTSW 9 119160716 frame shift probably null
R3779:Gm10608 UTSW 9 119160716 small deletion probably benign
R3839:Gm10608 UTSW 9 119160716 frame shift probably null
R3900:Gm10608 UTSW 9 119160716 frame shift probably null
R3947:Gm10608 UTSW 9 119160662 small deletion probably benign
R4015:Gm10608 UTSW 9 119160716 frame shift probably null
R4024:Gm10608 UTSW 9 119160716 small deletion probably benign
R5346:Gm10608 UTSW 9 119160724 frame shift probably null
R8225:Gm10608 UTSW 9 119160708 frame shift probably null
X0065:Gm10608 UTSW 9 119160863 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTGACAGGTGCCACAACAG -3'
(R):5'- TGCCTCTTCATAGGTCACATG -3'

Sequencing Primer
(F):5'- GTGCCACAACAGGGCAG -3'
(R):5'- TCAGATGGCAAAGCTTCCTG -3'
Posted On2014-11-11