Incidental Mutation 'R2372:Gm11596'
ID248178
Institutional Source Beutler Lab
Gene Symbol Gm11596
Ensembl Gene ENSMUSG00000078261
Gene Namepredicted gene 11596
Synonyms
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99792389-99793467 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 99793256 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 13 (E13*)
Ref Sequence ENSEMBL: ENSMUSP00000100679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105057] [ENSMUST00000105058]
Predicted Effect probably benign
Transcript: ENSMUST00000105057
SMART Domains Protein: ENSMUSP00000100678
Gene: ENSMUSG00000078260

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 52 1.2e-9 PFAM
Pfam:Keratin_B2 1 79 3.8e-12 PFAM
Pfam:Keratin_B2_2 39 83 1.1e-14 PFAM
Pfam:Keratin_B2_2 79 128 3.7e-10 PFAM
Pfam:Keratin_B2_2 101 148 1.7e-9 PFAM
Pfam:Keratin_B2_2 114 158 9.9e-13 PFAM
Pfam:Keratin_B2_2 139 180 4.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105058
AA Change: E13*
SMART Domains Protein: ENSMUSP00000100679
Gene: ENSMUSG00000078261
AA Change: E13*

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 48 2.7e-9 PFAM
Pfam:Keratin_B2 1 69 1.9e-10 PFAM
Pfam:Keratin_B2_2 14 58 1.1e-13 PFAM
Pfam:Keratin_B2_2 39 86 4.7e-11 PFAM
Pfam:Keratin_B2_2 84 128 8.2e-13 PFAM
Pfam:Keratin_B2_2 129 173 5.2e-12 PFAM
Pfam:Keratin_B2_2 164 205 3.7e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Gm11596
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Gm11596 APN 11 99792798 nonsense probably null
IGL02452:Gm11596 APN 11 99792980 missense unknown
BB005:Gm11596 UTSW 11 99792796 missense not run
BB015:Gm11596 UTSW 11 99792796 missense not run
R0256:Gm11596 UTSW 11 99792716 missense unknown
R0299:Gm11596 UTSW 11 99792944 missense unknown
R1126:Gm11596 UTSW 11 99792873 nonsense probably null
R2143:Gm11596 UTSW 11 99792963 nonsense probably null
R2144:Gm11596 UTSW 11 99792963 nonsense probably null
R4865:Gm11596 UTSW 11 99793238 unclassified probably benign
R5045:Gm11596 UTSW 11 99792869 missense unknown
R5076:Gm11596 UTSW 11 99792872 missense unknown
R5301:Gm11596 UTSW 11 99793021 missense unknown
R5579:Gm11596 UTSW 11 99792891 nonsense probably null
R6153:Gm11596 UTSW 11 99792698 missense unknown
R7467:Gm11596 UTSW 11 99793136 missense unknown
R7773:Gm11596 UTSW 11 99792841 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGCTAGAAATGCAGCAGC -3'
(R):5'- TTAGCCAGGAAATGAAACATGC -3'

Sequencing Primer
(F):5'- ATGCAGCAGCTAGGACGGC -3'
(R):5'- CCAGGAAATGAAACATGCCTAATG -3'
Posted On2014-11-11