Incidental Mutation 'R2372:Cpb2'
ID248179
Institutional Source Beutler Lab
Gene Symbol Cpb2
Ensembl Gene ENSMUSG00000021999
Gene Namecarboxypeptidase B2 (plasma)
Synonymscarboxypeptidase U, TAFI, carboxypeptidase R, CPR, CPU, 1110032P04Rik, thrombin-activatable fibrinolysis inhibitor, 4930405E17Rik
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75242287-75283555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 75268050 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 162 (V162G)
Ref Sequence ENSEMBL: ENSMUSP00000022576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022576]
Predicted Effect probably damaging
Transcript: ENSMUST00000022576
AA Change: V162G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022576
Gene: ENSMUSG00000021999
AA Change: V162G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Propep_M14 28 104 2.3e-17 PFAM
Zn_pept 122 406 2.1e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227817
Meta Mutation Damage Score 0.5661 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes carboxypeptidase B, a zinc-dependent metalloprotease that cleaves peptide bonds at the C-terminus of protein substrates. The encoded preproprotein undergoes proteolytic activation to generate a mature, functional enzyme, and secreted into plasma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice exhibit altered plasma clot lysis and may show reduced bleomycin-induced lung fibrosis, impaired healing of cutaneous wounds and colonic anastomoses, altered glomerular structure, or complement-mediated lethal inflammation after LPS sensitization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Cpb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Cpb2 APN 14 75275093 missense possibly damaging 0.64
IGL00925:Cpb2 APN 14 75260750 missense possibly damaging 0.56
IGL01069:Cpb2 APN 14 75270775 missense probably damaging 1.00
IGL01521:Cpb2 APN 14 75257631 missense probably damaging 1.00
IGL02331:Cpb2 APN 14 75283404 missense possibly damaging 0.93
IGL02947:Cpb2 APN 14 75283318 missense probably damaging 1.00
IGL02961:Cpb2 APN 14 75265383 missense probably benign
PIT4677001:Cpb2 UTSW 14 75256023 missense probably benign
R0271:Cpb2 UTSW 14 75257709 splice site probably null
R0277:Cpb2 UTSW 14 75265458 missense probably damaging 1.00
R0372:Cpb2 UTSW 14 75242377 missense probably benign 0.01
R1893:Cpb2 UTSW 14 75255963 missense probably benign 0.44
R1926:Cpb2 UTSW 14 75242397 missense probably benign 0.07
R2923:Cpb2 UTSW 14 75256033 critical splice donor site probably null
R3714:Cpb2 UTSW 14 75283217 splice site probably null
R5958:Cpb2 UTSW 14 75283387 missense probably damaging 1.00
R5987:Cpb2 UTSW 14 75260688 missense probably damaging 1.00
R6354:Cpb2 UTSW 14 75257705 critical splice donor site probably null
R6495:Cpb2 UTSW 14 75275079 missense probably damaging 1.00
R6984:Cpb2 UTSW 14 75265458 missense possibly damaging 0.78
R7211:Cpb2 UTSW 14 75274990 missense probably damaging 1.00
R7380:Cpb2 UTSW 14 75256009 missense possibly damaging 0.77
R7444:Cpb2 UTSW 14 75283342 missense probably damaging 0.99
R7625:Cpb2 UTSW 14 75272549 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGTGGTGCCTATGATGAGC -3'
(R):5'- GGGATTCTGACTCCAGTGATC -3'

Sequencing Primer
(F):5'- AACAGTCTGGCTTCAATATCACTC -3'
(R):5'- GACTCCAGTGATCTTGGATCCCAG -3'
Posted On2014-11-11