Incidental Mutation 'R2372:Fyb'
ID248180
Institutional Source Beutler Lab
Gene Symbol Fyb
Ensembl Gene ENSMUSG00000022148
Gene NameFYN binding protein
SynonymsB630013F22Rik, ADAP, FYB-120/130
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6522853-6663313 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 6651907 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000090461]
Predicted Effect probably benign
Transcript: ENSMUST00000090461
SMART Domains Protein: ENSMUSP00000087947
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
low complexity region 371 409 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 457 494 N/A INTRINSIC
SH3 502 559 1.24e-3 SMART
low complexity region 611 626 N/A INTRINSIC
Pfam:hSH3 731 819 2.9e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162154
Predicted Effect probably benign
Transcript: ENSMUST00000163073
SMART Domains Protein: ENSMUSP00000123895
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:hSH3 86 170 4.1e-42 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: The protein encoded by this gene is an adapter molecule that affects T cell receptor signaling and contains multiple protein-protein interaction domains. It is thought to couple T cell receptor stimulation with activation of integrin function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation, thymocytes and platelet counts and decreased TCR-stimulated leukocyte adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Fyb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fyb APN 15 6580777 missense probably damaging 0.99
IGL00801:Fyb APN 15 6644824 missense possibly damaging 0.86
IGL00974:Fyb APN 15 6642585 unclassified probably benign
IGL01377:Fyb APN 15 6580320 missense probably benign 0.01
IGL01982:Fyb APN 15 6580177 missense probably null 0.99
IGL02173:Fyb APN 15 6580695 missense probably benign 0.00
IGL02177:Fyb APN 15 6658566 critical splice donor site probably null
IGL02345:Fyb APN 15 6619662 missense possibly damaging 0.94
IGL02695:Fyb APN 15 6580921 missense probably damaging 1.00
IGL02820:Fyb APN 15 6658559 missense possibly damaging 0.65
IGL02867:Fyb APN 15 6580046 missense probably damaging 1.00
luegner UTSW 15 6580869 nonsense probably null
uebeltaeter UTSW 15 6638907 missense probably damaging 1.00
P0023:Fyb UTSW 15 6651854 missense probably damaging 1.00
R0028:Fyb UTSW 15 6644914 intron probably benign
R0364:Fyb UTSW 15 6580791 missense probably damaging 1.00
R0507:Fyb UTSW 15 6634816 missense probably benign 0.39
R0588:Fyb UTSW 15 6580459 missense probably benign 0.03
R0742:Fyb UTSW 15 6634816 missense probably benign 0.39
R0930:Fyb UTSW 15 6638828 missense probably damaging 1.00
R1184:Fyb UTSW 15 6638900 missense probably damaging 1.00
R1446:Fyb UTSW 15 6652466 missense probably benign 0.02
R1481:Fyb UTSW 15 6619647 missense probably benign 0.01
R1711:Fyb UTSW 15 6580479 missense probably damaging 1.00
R2041:Fyb UTSW 15 6644787 missense possibly damaging 0.78
R2176:Fyb UTSW 15 6579954 missense probably damaging 1.00
R2224:Fyb UTSW 15 6652383 missense probably damaging 1.00
R3236:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4117:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4181:Fyb UTSW 15 6580923 missense probably benign 0.00
R4322:Fyb UTSW 15 6580819 missense possibly damaging 0.84
R4952:Fyb UTSW 15 6638811 missense probably damaging 1.00
R4981:Fyb UTSW 15 6646611 splice site probably benign
R5055:Fyb UTSW 15 6585149 unclassified probably benign
R5368:Fyb UTSW 15 6580678 unclassified probably null
R5719:Fyb UTSW 15 6580869 nonsense probably null
R5822:Fyb UTSW 15 6663226 unclassified probably benign
R6064:Fyb UTSW 15 6638868 missense probably damaging 1.00
R6929:Fyb UTSW 15 6638907 missense probably damaging 1.00
R7125:Fyb UTSW 15 6644856 missense possibly damaging 0.77
R7243:Fyb UTSW 15 6643699 missense probably benign 0.19
R7748:Fyb UTSW 15 6638826 missense probably damaging 1.00
R7750:Fyb UTSW 15 6660703 missense probably damaging 1.00
R7902:Fyb UTSW 15 6660716 critical splice donor site probably null
R7985:Fyb UTSW 15 6660716 critical splice donor site probably null
R8182:Fyb UTSW 15 6651812 missense probably benign
Z1088:Fyb UTSW 15 6658540 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ATGAACCCCATCTATCTGTCAGAAAG -3'
(R):5'- TGTACTGACAAATTTACTAAGAAGGGT -3'

Sequencing Primer
(F):5'- CAGCCTGGTCTACATGTATACAGTG -3'
(R):5'- AGAAGGGTTTTGCTCTACACATGC -3'
Posted On2014-11-11