Incidental Mutation 'R2372:Dok6'
ID248184
Institutional Source Beutler Lab
Gene Symbol Dok6
Ensembl Gene ENSMUSG00000073514
Gene Namedocking protein 6
SynonymsDok-6
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location89301082-89769528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 89414864 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 274 (R274G)
Ref Sequence ENSEMBL: ENSMUSP00000095103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097495]
Predicted Effect probably null
Transcript: ENSMUST00000097495
AA Change: R274G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095103
Gene: ENSMUSG00000073514
AA Change: R274G

DomainStartEndE-ValueType
PH 8 114 8.99e-7 SMART
PTBI 130 232 4.39e-45 SMART
IRS 135 232 4.87e-41 SMART
low complexity region 316 328 N/A INTRINSIC
Meta Mutation Damage Score 0.1652 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DOK6 is a member of the DOK (see DOK1; MIM 602919) family of intracellular adaptors that play a role in the RET (MIM 164761) signaling cascade (Crowder et al., 2004 [PubMed 15286081]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Dok6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1884:Dok6 UTSW 18 89474006 missense probably damaging 1.00
R1984:Dok6 UTSW 18 89560110 missense probably damaging 1.00
R2369:Dok6 UTSW 18 89414864 missense probably null 0.00
R4572:Dok6 UTSW 18 89473947 missense possibly damaging 0.95
R4587:Dok6 UTSW 18 89301196 missense probably benign 0.06
R4658:Dok6 UTSW 18 89473847 splice site probably benign
R5241:Dok6 UTSW 18 89598789 missense possibly damaging 0.77
R5995:Dok6 UTSW 18 89421018 missense possibly damaging 0.89
R7498:Dok6 UTSW 18 89769319 start gained probably benign
R7614:Dok6 UTSW 18 89473943 missense probably damaging 1.00
R7840:Dok6 UTSW 18 89560058 missense probably benign 0.00
R8041:Dok6 UTSW 18 89560089 missense possibly damaging 0.93
R8158:Dok6 UTSW 18 89473947 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTTGCACCCTGAGAAAGTTG -3'
(R):5'- TTGACACAGCTATCCTTGAATAGGG -3'

Sequencing Primer
(F):5'- TTGCACCCTGAGAAAGTTGATAAGTG -3'
(R):5'- ATCCTTGAATAGGGAATTATCTGGG -3'
Posted On2014-11-11