Incidental Mutation 'R2373:Asxl1'
ID 248196
Institutional Source Beutler Lab
Gene Symbol Asxl1
Ensembl Gene ENSMUSG00000042548
Gene Name additional sex combs like 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2373 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 153345829-153404007 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 153401900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1458 (T1458A)
Ref Sequence ENSEMBL: ENSMUSP00000105413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]
AlphaFold P59598
Predicted Effect probably benign
Transcript: ENSMUST00000109790
AA Change: T1458A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: T1458A

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-20 PFAM
low complexity region 199 209 N/A INTRINSIC
Pfam:ASXH 236 361 5.9e-40 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
Pfam:PHD_3 1446 1512 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227428
AA Change: T1457A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9130023H24Rik A T 7: 128,237,315 D35E probably benign Het
9330159F19Rik A G 10: 29,225,043 N471D probably benign Het
Ahctf1 A T 1: 179,795,796 F86I probably damaging Het
Alpk1 T C 3: 127,679,808 T849A probably benign Het
Arfgef1 A T 1: 10,174,142 D965E probably damaging Het
Cdc42bpa A T 1: 180,111,784 M876L possibly damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Col12a1 A T 9: 79,656,813 V1710E probably benign Het
Corin G A 5: 72,339,038 S524L probably damaging Het
Dennd2c A G 3: 103,156,842 H658R probably damaging Het
Disp3 A G 4: 148,258,795 V553A probably damaging Het
Dpm2 T C 2: 32,572,445 F81S probably benign Het
Emc2 T A 15: 43,513,758 I239N probably damaging Het
Fam160a1 C T 3: 85,676,097 W464* probably null Het
Fzd5 C T 1: 64,734,907 G565D probably damaging Het
Gpld1 T C 13: 24,962,856 F267S probably benign Het
Kif14 C A 1: 136,479,845 A46E probably damaging Het
Mta3 G T 17: 83,784,301 E179* probably null Het
Ninl T G 2: 150,980,117 T22P probably damaging Het
Pcnx2 T C 8: 125,753,451 N2039S probably damaging Het
Rc3h2 A G 2: 37,379,001 S818P possibly damaging Het
Scn11a T A 9: 119,813,186 E162D probably benign Het
Slc5a7 A T 17: 54,277,126 W379R probably damaging Het
Sptb C T 12: 76,621,161 V721M probably damaging Het
Vmn1r82 T A 7: 12,305,055 V85E probably damaging Het
Vmn2r93 T A 17: 18,298,403 F41L probably benign Het
Vmn2r-ps130 T C 17: 23,061,506 I47T possibly damaging Het
Other mutations in Asxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Asxl1 APN 2 153392940 splice site probably benign
IGL01432:Asxl1 APN 2 153400205 missense probably benign 0.38
IGL01543:Asxl1 APN 2 153401484 missense probably benign 0.11
IGL02355:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02362:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02645:Asxl1 APN 2 153392857 missense possibly damaging 0.94
IGL02696:Asxl1 APN 2 153400195 nonsense probably null
IGL03365:Asxl1 APN 2 153401754 missense probably damaging 1.00
IGL03372:Asxl1 APN 2 153400413 missense probably damaging 0.99
IGL03377:Asxl1 APN 2 153396780 missense probably damaging 1.00
astrophel UTSW 2 153400106 missense possibly damaging 0.75
hairbrush UTSW 2 153400724 missense possibly damaging 0.55
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0600:Asxl1 UTSW 2 153399904 missense probably benign 0.00
R0659:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0661:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0684:Asxl1 UTSW 2 153397522 missense probably damaging 1.00
R1606:Asxl1 UTSW 2 153400455 missense probably damaging 0.99
R1747:Asxl1 UTSW 2 153393454 missense possibly damaging 0.86
R1796:Asxl1 UTSW 2 153401606 missense probably benign 0.31
R1914:Asxl1 UTSW 2 153401906 missense probably damaging 1.00
R2099:Asxl1 UTSW 2 153352267 missense possibly damaging 0.95
R2910:Asxl1 UTSW 2 153401039 missense probably benign 0.00
R3620:Asxl1 UTSW 2 153357155 missense probably damaging 1.00
R3701:Asxl1 UTSW 2 153399344 missense probably benign 0.04
R4200:Asxl1 UTSW 2 153400106 missense possibly damaging 0.75
R4773:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
R4902:Asxl1 UTSW 2 153399831 missense probably benign 0.02
R5100:Asxl1 UTSW 2 153397931 missense probably damaging 1.00
R5102:Asxl1 UTSW 2 153400955 missense probably benign 0.00
R5166:Asxl1 UTSW 2 153401121 missense probably damaging 1.00
R5421:Asxl1 UTSW 2 153399584 missense probably benign 0.04
R5701:Asxl1 UTSW 2 153399489 missense probably damaging 1.00
R5861:Asxl1 UTSW 2 153399390 missense probably damaging 0.99
R5973:Asxl1 UTSW 2 153402011 missense probably damaging 0.97
R6384:Asxl1 UTSW 2 153391824 critical splice donor site probably null
R7023:Asxl1 UTSW 2 153400549 missense probably benign 0.00
R7028:Asxl1 UTSW 2 153400107 missense probably benign 0.00
R7176:Asxl1 UTSW 2 153401988 missense probably damaging 1.00
R7297:Asxl1 UTSW 2 153397435 missense probably benign 0.01
R7378:Asxl1 UTSW 2 153401993 missense probably damaging 1.00
R7464:Asxl1 UTSW 2 153397785 missense probably benign 0.01
R7678:Asxl1 UTSW 2 153400652 missense probably damaging 1.00
R7686:Asxl1 UTSW 2 153391614 missense probably damaging 1.00
R7789:Asxl1 UTSW 2 153400023 missense probably benign 0.00
R7838:Asxl1 UTSW 2 153396813 missense probably damaging 1.00
R7898:Asxl1 UTSW 2 153399934 missense possibly damaging 0.65
R8281:Asxl1 UTSW 2 153399401 missense probably damaging 1.00
R8354:Asxl1 UTSW 2 153393425 missense probably benign 0.40
R8383:Asxl1 UTSW 2 153393719 missense probably damaging 1.00
R8995:Asxl1 UTSW 2 153393966 missense probably damaging 1.00
R9183:Asxl1 UTSW 2 153397920 missense probably damaging 0.99
X0024:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGGAAAGGGTTCAGTCAAC -3'
(R):5'- ATGTACAATGTTTCCAATGGCC -3'

Sequencing Primer
(F):5'- TTCAGTCAACCCCTGGAGC -3'
(R):5'- TGGCCATAATTTATTATCTCACCAC -3'
Posted On 2014-11-11