Incidental Mutation 'R2373:Dennd2c'
ID248198
Institutional Source Beutler Lab
Gene Symbol Dennd2c
Ensembl Gene ENSMUSG00000007379
Gene NameDENN/MADD domain containing 2C
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2373 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103102604-103169769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103156842 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 658 (H658R)
Ref Sequence ENSEMBL: ENSMUSP00000127187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172288] [ENSMUST00000173206]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166143
Predicted Effect probably damaging
Transcript: ENSMUST00000172288
AA Change: H658R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127187
Gene: ENSMUSG00000007379
AA Change: H658R

DomainStartEndE-ValueType
uDENN 481 571 1.01e-25 SMART
DENN 578 762 3.36e-77 SMART
dDENN 806 873 1.15e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173037
Predicted Effect possibly damaging
Transcript: ENSMUST00000173206
AA Change: H601R

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134008
Gene: ENSMUSG00000007379
AA Change: H601R

DomainStartEndE-ValueType
uDENN 424 514 1.01e-25 SMART
DENN 521 705 3.36e-77 SMART
dDENN 749 816 1.15e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174486
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9130023H24Rik A T 7: 128,237,315 D35E probably benign Het
9330159F19Rik A G 10: 29,225,043 N471D probably benign Het
Ahctf1 A T 1: 179,795,796 F86I probably damaging Het
Alpk1 T C 3: 127,679,808 T849A probably benign Het
Arfgef1 A T 1: 10,174,142 D965E probably damaging Het
Asxl1 A G 2: 153,401,900 T1458A probably benign Het
Cdc42bpa A T 1: 180,111,784 M876L possibly damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Col12a1 A T 9: 79,656,813 V1710E probably benign Het
Corin G A 5: 72,339,038 S524L probably damaging Het
Disp3 A G 4: 148,258,795 V553A probably damaging Het
Dpm2 T C 2: 32,572,445 F81S probably benign Het
Emc2 T A 15: 43,513,758 I239N probably damaging Het
Fam160a1 C T 3: 85,676,097 W464* probably null Het
Fzd5 C T 1: 64,734,907 G565D probably damaging Het
Gpld1 T C 13: 24,962,856 F267S probably benign Het
Kif14 C A 1: 136,479,845 A46E probably damaging Het
Mta3 G T 17: 83,784,301 E179* probably null Het
Ninl T G 2: 150,980,117 T22P probably damaging Het
Pcnx2 T C 8: 125,753,451 N2039S probably damaging Het
Rc3h2 A G 2: 37,379,001 S818P possibly damaging Het
Scn11a T A 9: 119,813,186 E162D probably benign Het
Slc5a7 A T 17: 54,277,126 W379R probably damaging Het
Sptb C T 12: 76,621,161 V721M probably damaging Het
Vmn1r82 T A 7: 12,305,055 V85E probably damaging Het
Vmn2r93 T A 17: 18,298,403 F41L probably benign Het
Vmn2r-ps130 T C 17: 23,061,506 I47T possibly damaging Het
Other mutations in Dennd2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Dennd2c APN 3 103156908 missense probably damaging 1.00
IGL01791:Dennd2c APN 3 103166425 missense probably benign 0.19
IGL02100:Dennd2c APN 3 103153675 missense probably damaging 0.98
IGL02119:Dennd2c APN 3 103137243 missense probably damaging 0.99
IGL02395:Dennd2c APN 3 103157765 missense probably benign 0.00
IGL02631:Dennd2c APN 3 103156071 missense possibly damaging 0.56
IGL02895:Dennd2c APN 3 103137203 missense possibly damaging 0.76
R1749:Dennd2c UTSW 3 103132036 missense possibly damaging 0.92
R1931:Dennd2c UTSW 3 103133252 missense probably benign 0.32
R1964:Dennd2c UTSW 3 103166491 missense probably damaging 1.00
R1972:Dennd2c UTSW 3 103131698 missense probably benign 0.01
R1973:Dennd2c UTSW 3 103131698 missense probably benign 0.01
R2025:Dennd2c UTSW 3 103131689 missense possibly damaging 0.71
R2350:Dennd2c UTSW 3 103132001 missense probably benign 0.00
R4555:Dennd2c UTSW 3 103131886 missense probably benign 0.00
R4916:Dennd2c UTSW 3 103131824 missense probably benign 0.00
R5560:Dennd2c UTSW 3 103161555 missense probably damaging 1.00
R6291:Dennd2c UTSW 3 103131609 nonsense probably null
R6395:Dennd2c UTSW 3 103149224 critical splice donor site probably null
R6567:Dennd2c UTSW 3 103132019 missense probably benign 0.02
R6681:Dennd2c UTSW 3 103131661 missense probably benign 0.01
R7106:Dennd2c UTSW 3 103131577 missense possibly damaging 0.82
R7162:Dennd2c UTSW 3 103156107 missense probably damaging 1.00
R7514:Dennd2c UTSW 3 103163062 missense probably benign 0.00
R7591:Dennd2c UTSW 3 103133345 missense possibly damaging 0.51
R7698:Dennd2c UTSW 3 103165043 missense possibly damaging 0.65
R8069:Dennd2c UTSW 3 103165130 missense probably damaging 1.00
R8086:Dennd2c UTSW 3 103133345 missense possibly damaging 0.51
R8247:Dennd2c UTSW 3 103152321 missense probably damaging 0.99
R8347:Dennd2c UTSW 3 103157709 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATAAACCCTTTGTGCCACAC -3'
(R):5'- GTACAGAAGCCTTTCAATTTCTTTC -3'

Sequencing Primer
(F):5'- AGAACTCTCTGTAGTCCAGGCTG -3'
(R):5'- CAATTAGTGAGTCAGGTCTCTAGCC -3'
Posted On2014-11-11