Incidental Mutation 'R2373:Emc2'
ID248212
Institutional Source Beutler Lab
Gene Symbol Emc2
Ensembl Gene ENSMUSG00000022337
Gene NameER membrane protein complex subunit 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R2373 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location43477229-43527763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43513758 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 239 (I239N)
Ref Sequence ENSEMBL: ENSMUSP00000022962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022962]
Predicted Effect probably damaging
Transcript: ENSMUST00000022962
AA Change: I239N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022962
Gene: ENSMUSG00000022337
AA Change: I239N

DomainStartEndE-ValueType
coiled coil region 13 36 N/A INTRINSIC
Pfam:TPR_2 88 120 6.8e-5 PFAM
Pfam:TPR_19 98 151 5.9e-8 PFAM
Pfam:TPR_19 131 198 3.7e-8 PFAM
Pfam:TPR_2 155 188 2.4e-6 PFAM
Pfam:TPR_8 155 188 1.4e-4 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9130023H24Rik A T 7: 128,237,315 D35E probably benign Het
9330159F19Rik A G 10: 29,225,043 N471D probably benign Het
Ahctf1 A T 1: 179,795,796 F86I probably damaging Het
Alpk1 T C 3: 127,679,808 T849A probably benign Het
Arfgef1 A T 1: 10,174,142 D965E probably damaging Het
Asxl1 A G 2: 153,401,900 T1458A probably benign Het
Cdc42bpa A T 1: 180,111,784 M876L possibly damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Col12a1 A T 9: 79,656,813 V1710E probably benign Het
Corin G A 5: 72,339,038 S524L probably damaging Het
Dennd2c A G 3: 103,156,842 H658R probably damaging Het
Disp3 A G 4: 148,258,795 V553A probably damaging Het
Dpm2 T C 2: 32,572,445 F81S probably benign Het
Fam160a1 C T 3: 85,676,097 W464* probably null Het
Fzd5 C T 1: 64,734,907 G565D probably damaging Het
Gpld1 T C 13: 24,962,856 F267S probably benign Het
Kif14 C A 1: 136,479,845 A46E probably damaging Het
Mta3 G T 17: 83,784,301 E179* probably null Het
Ninl T G 2: 150,980,117 T22P probably damaging Het
Pcnx2 T C 8: 125,753,451 N2039S probably damaging Het
Rc3h2 A G 2: 37,379,001 S818P possibly damaging Het
Scn11a T A 9: 119,813,186 E162D probably benign Het
Slc5a7 A T 17: 54,277,126 W379R probably damaging Het
Sptb C T 12: 76,621,161 V721M probably damaging Het
Vmn1r82 T A 7: 12,305,055 V85E probably damaging Het
Vmn2r93 T A 17: 18,298,403 F41L probably benign Het
Vmn2r-ps130 T C 17: 23,061,506 I47T possibly damaging Het
Other mutations in Emc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Emc2 APN 15 43511749 missense probably damaging 1.00
IGL02815:Emc2 APN 15 43507930 splice site probably benign
IGL03211:Emc2 APN 15 43507672 nonsense probably null
IGL03238:Emc2 APN 15 43507853 splice site probably null
R0433:Emc2 UTSW 15 43497124 splice site probably null
R1965:Emc2 UTSW 15 43527467 missense probably damaging 1.00
R2507:Emc2 UTSW 15 43511698 critical splice acceptor site probably null
R4986:Emc2 UTSW 15 43511784 missense probably benign 0.29
R5212:Emc2 UTSW 15 43510844 missense probably damaging 1.00
R5368:Emc2 UTSW 15 43511811 critical splice donor site probably null
R5751:Emc2 UTSW 15 43497057 splice site probably null
R8136:Emc2 UTSW 15 43511806 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGCTCTAAGGGCTGATGTAAATAC -3'
(R):5'- GCATCTTCTAGTTTAACGTCGGG -3'

Sequencing Primer
(F):5'- TCATGTTATTTTGGACTATGCTGC -3'
(R):5'- AACGTCGGGGTTTTATAATTCTTTTC -3'
Posted On2014-11-11