Incidental Mutation 'R2373:Vmn2r-ps130'
ID248214
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps130
Ensembl Gene ENSMUSG00000095658
Gene Namevomeronasal 2, receptor, pseudogene 130
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R2373 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23061367-23077425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23061506 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 47 (I47T)
Ref Sequence ENSEMBL: ENSMUSP00000135186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175853]
Predicted Effect possibly damaging
Transcript: ENSMUST00000175853
AA Change: I47T

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135186
Gene: ENSMUSG00000095658
AA Change: I47T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 76 469 5.4e-24 PFAM
Pfam:NCD3G 511 563 1.3e-21 PFAM
Pfam:7tm_3 594 831 2.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9130023H24Rik A T 7: 128,237,315 D35E probably benign Het
9330159F19Rik A G 10: 29,225,043 N471D probably benign Het
Ahctf1 A T 1: 179,795,796 F86I probably damaging Het
Alpk1 T C 3: 127,679,808 T849A probably benign Het
Arfgef1 A T 1: 10,174,142 D965E probably damaging Het
Asxl1 A G 2: 153,401,900 T1458A probably benign Het
Cdc42bpa A T 1: 180,111,784 M876L possibly damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Col12a1 A T 9: 79,656,813 V1710E probably benign Het
Corin G A 5: 72,339,038 S524L probably damaging Het
Dennd2c A G 3: 103,156,842 H658R probably damaging Het
Disp3 A G 4: 148,258,795 V553A probably damaging Het
Dpm2 T C 2: 32,572,445 F81S probably benign Het
Emc2 T A 15: 43,513,758 I239N probably damaging Het
Fam160a1 C T 3: 85,676,097 W464* probably null Het
Fzd5 C T 1: 64,734,907 G565D probably damaging Het
Gpld1 T C 13: 24,962,856 F267S probably benign Het
Kif14 C A 1: 136,479,845 A46E probably damaging Het
Mta3 G T 17: 83,784,301 E179* probably null Het
Ninl T G 2: 150,980,117 T22P probably damaging Het
Pcnx2 T C 8: 125,753,451 N2039S probably damaging Het
Rc3h2 A G 2: 37,379,001 S818P possibly damaging Het
Scn11a T A 9: 119,813,186 E162D probably benign Het
Slc5a7 A T 17: 54,277,126 W379R probably damaging Het
Sptb C T 12: 76,621,161 V721M probably damaging Het
Vmn1r82 T A 7: 12,305,055 V85E probably damaging Het
Vmn2r93 T A 17: 18,298,403 F41L probably benign Het
Other mutations in Vmn2r-ps130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Vmn2r-ps130 APN 17 23076877 missense possibly damaging 0.79
IGL02346:Vmn2r-ps130 APN 17 23061527 missense possibly damaging 0.89
IGL02373:Vmn2r-ps130 APN 17 23076892 nonsense probably null
R1511:Vmn2r-ps130 UTSW 17 23063801 missense probably benign 0.17
R5047:Vmn2r-ps130 UTSW 17 23063820 missense probably benign
R5317:Vmn2r-ps130 UTSW 17 23063583 missense probably benign
R5588:Vmn2r-ps130 UTSW 17 23063829 missense probably benign 0.44
R5785:Vmn2r-ps130 UTSW 17 23061487 missense probably benign
R6131:Vmn2r-ps130 UTSW 17 23063655 missense probably benign 0.00
R6273:Vmn2r-ps130 UTSW 17 23076785 missense probably benign 0.12
R6580:Vmn2r-ps130 UTSW 17 23063766 missense probably benign 0.00
R7660:Vmn2r-ps130 UTSW 17 23077032 missense probably damaging 1.00
R7852:Vmn2r-ps130 UTSW 17 23063814 missense probably benign 0.04
R7935:Vmn2r-ps130 UTSW 17 23063814 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGGCACTTCACAAACCATTC -3'
(R):5'- CTATAAATGGAAGGCAGGCTTG -3'

Sequencing Primer
(F):5'- TTCTGCCCAGCCTCAGAGAAG -3'
(R):5'- ATATGGAGTTCTTTCTTGTTTTGCAC -3'
Posted On2014-11-11