Incidental Mutation 'R2374:Zbtb26'
ID248218
Institutional Source Beutler Lab
Gene Symbol Zbtb26
Ensembl Gene ENSMUSG00000050714
Gene Namezinc finger and BTB domain containing 26
SynonymsA630026F21Rik
MMRRC Submission 040353-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R2374 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37432168-37443135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37436485 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 180 (S180P)
Ref Sequence ENSEMBL: ENSMUSP00000099850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067043] [ENSMUST00000102789] [ENSMUST00000112932]
Predicted Effect probably benign
Transcript: ENSMUST00000067043
AA Change: S169P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070071
Gene: ENSMUSG00000050714
AA Change: S169P

DomainStartEndE-ValueType
BTB 33 127 4.38e-12 SMART
low complexity region 169 179 N/A INTRINSIC
ZnF_C2H2 273 295 1.36e-2 SMART
ZnF_C2H2 298 320 1.4e-4 SMART
ZnF_C2H2 326 348 2.99e-4 SMART
ZnF_C2H2 354 377 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102789
AA Change: S180P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099850
Gene: ENSMUSG00000050714
AA Change: S180P

DomainStartEndE-ValueType
BTB 44 138 4.38e-12 SMART
low complexity region 180 190 N/A INTRINSIC
ZnF_C2H2 284 306 1.36e-2 SMART
ZnF_C2H2 309 331 1.4e-4 SMART
ZnF_C2H2 337 359 2.99e-4 SMART
ZnF_C2H2 365 388 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112932
SMART Domains Protein: ENSMUSP00000108554
Gene: ENSMUSG00000066798

DomainStartEndE-ValueType
BTB 33 127 2.67e-16 SMART
Blast:BTB 161 196 1e-5 BLAST
ZnF_C2H2 300 322 7.15e-2 SMART
ZnF_C2H2 325 347 1.58e-3 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
ZnF_C2H2 381 404 8.81e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203522
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,820,574 Y60H probably damaging Het
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Clec4b1 T G 6: 123,050,638 L18R probably damaging Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Ly6e A G 15: 74,958,621 S107G probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr1272 A T 2: 90,282,451 S41R possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tbc1d12 T A 19: 38,837,170 L155Q possibly damaging Het
Tnni3k A T 3: 154,786,785 M816K probably benign Het
Ugt2a3 T C 5: 87,327,191 D398G probably damaging Het
Vmn1r25 A T 6: 57,978,558 S249T probably benign Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zfy1 A T Y: 726,391 L458Q probably damaging Het
Zfy1 G C Y: 726,392 L458V possibly damaging Het
Zmpste24 T C 4: 121,074,537 E297G probably benign Het
Other mutations in Zbtb26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Zbtb26 APN 2 37436442 missense possibly damaging 0.82
IGL00899:Zbtb26 APN 2 37436258 nonsense probably null
IGL01598:Zbtb26 APN 2 37436271 missense probably damaging 1.00
IGL01940:Zbtb26 APN 2 37435975 missense possibly damaging 0.93
IGL02152:Zbtb26 APN 2 37436691 missense possibly damaging 0.95
IGL02867:Zbtb26 APN 2 37436249 missense probably benign 0.00
IGL02889:Zbtb26 APN 2 37436249 missense probably benign 0.00
IGL03081:Zbtb26 APN 2 37436600 missense possibly damaging 0.67
R0138:Zbtb26 UTSW 2 37436041 missense probably benign 0.16
R0328:Zbtb26 UTSW 2 37436795 missense possibly damaging 0.81
R0927:Zbtb26 UTSW 2 37436325 missense possibly damaging 0.91
R1671:Zbtb26 UTSW 2 37436365 missense probably benign 0.00
R1813:Zbtb26 UTSW 2 37436335 missense possibly damaging 0.68
R1896:Zbtb26 UTSW 2 37436335 missense possibly damaging 0.68
R2128:Zbtb26 UTSW 2 37436551 missense probably benign 0.00
R4050:Zbtb26 UTSW 2 37436988 start codon destroyed probably null 0.46
R4631:Zbtb26 UTSW 2 37436956 missense probably benign 0.00
R4940:Zbtb26 UTSW 2 37436769 missense probably damaging 0.98
R5071:Zbtb26 UTSW 2 37435929 missense probably benign 0.26
R6348:Zbtb26 UTSW 2 37435675 missense probably benign 0.43
R6962:Zbtb26 UTSW 2 37436094 missense possibly damaging 0.71
R6990:Zbtb26 UTSW 2 37436545 missense probably benign 0.00
R7261:Zbtb26 UTSW 2 37436655 missense possibly damaging 0.71
R7981:Zbtb26 UTSW 2 37436875 missense possibly damaging 0.51
R8013:Zbtb26 UTSW 2 37437001 critical splice acceptor site probably null
R8014:Zbtb26 UTSW 2 37437001 critical splice acceptor site probably null
R8872:Zbtb26 UTSW 2 37436901 missense probably damaging 0.99
R8876:Zbtb26 UTSW 2 37436884 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTGCCTGTGTAAGAGAGGGC -3'
(R):5'- AGCCACATTGTAGAACGGTGC -3'

Sequencing Primer
(F):5'- AGATGGCTCTGGTCTAGTTCATTAAC -3'
(R):5'- CACATTGTAGAACGGTGCACACAG -3'
Posted On2014-11-11