Incidental Mutation 'R2374:Olfr1272'
ID248220
Institutional Source Beutler Lab
Gene Symbol Olfr1272
Ensembl Gene ENSMUSG00000075061
Gene Nameolfactory receptor 1272
SynonymsGA_x6K02T2Q125-51636504-51635578, MOR227-3
MMRRC Submission 040353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R2374 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90280263-90292841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90282451 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 41 (S41R)
Ref Sequence ENSEMBL: ENSMUSP00000150745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099750] [ENSMUST00000117141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099750
AA Change: S41R

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097339
Gene: ENSMUSG00000075061
AA Change: S41R

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 7.5e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.5e-5 PFAM
Pfam:7tm_1 39 285 1.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117141
AA Change: S41R

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,820,574 Y60H probably damaging Het
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Clec4b1 T G 6: 123,050,638 L18R probably damaging Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Ly6e A G 15: 74,958,621 S107G probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tbc1d12 T A 19: 38,837,170 L155Q possibly damaging Het
Tnni3k A T 3: 154,786,785 M816K probably benign Het
Ugt2a3 T C 5: 87,327,191 D398G probably damaging Het
Vmn1r25 A T 6: 57,978,558 S249T probably benign Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zbtb26 A G 2: 37,436,485 S180P probably benign Het
Zfy1 A T Y: 726,391 L458Q probably damaging Het
Zfy1 G C Y: 726,392 L458V possibly damaging Het
Zmpste24 T C 4: 121,074,537 E297G probably benign Het
Other mutations in Olfr1272
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Olfr1272 APN 2 90282081 missense possibly damaging 0.55
IGL01824:Olfr1272 APN 2 90281919 missense probably damaging 1.00
IGL01951:Olfr1272 APN 2 90282007 missense probably damaging 1.00
IGL02473:Olfr1272 APN 2 90281696 missense probably null 1.00
IGL02494:Olfr1272 APN 2 90281951 missense probably benign 0.35
IGL03410:Olfr1272 APN 2 90282213 missense probably damaging 1.00
R0350:Olfr1272 UTSW 2 90282582 splice site probably null
R0363:Olfr1272 UTSW 2 90281856 missense probably damaging 1.00
R0401:Olfr1272 UTSW 2 90282404 missense probably damaging 1.00
R0666:Olfr1272 UTSW 2 90281868 missense probably damaging 0.96
R1860:Olfr1272 UTSW 2 90282158 missense probably damaging 1.00
R1861:Olfr1272 UTSW 2 90282158 missense probably damaging 1.00
R4256:Olfr1272 UTSW 2 90282062 missense probably damaging 1.00
R4737:Olfr1272 UTSW 2 90282381 missense probably damaging 1.00
R4827:Olfr1272 UTSW 2 90282203 missense probably damaging 1.00
R5198:Olfr1272 UTSW 2 90296393 missense probably damaging 1.00
R5589:Olfr1272 UTSW 2 90281969 missense probably damaging 1.00
R6412:Olfr1272 UTSW 2 90281858 missense probably damaging 1.00
R7130:Olfr1272 UTSW 2 90281922 missense probably benign
R7317:Olfr1272 UTSW 2 90282404 missense probably damaging 1.00
R7497:Olfr1272 UTSW 2 90281754 missense possibly damaging 0.74
R7762:Olfr1272 UTSW 2 90296631 nonsense probably null
R8271:Olfr1272 UTSW 2 90282272 missense possibly damaging 0.74
R8347:Olfr1272 UTSW 2 90281676 missense probably benign 0.22
R8794:Olfr1272 UTSW 2 90281806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAGCAGGAGAATCTCAGC -3'
(R):5'- TGTGCTGCAATGCTTTGAC -3'

Sequencing Primer
(F):5'- AGAAGAATATCTGAGCCAGACAGCC -3'
(R):5'- TGACTCCATGGCCAACAA -3'
Posted On2014-11-11