Incidental Mutation 'R2374:4930402H24Rik'
ID248221
Institutional Source Beutler Lab
Gene Symbol 4930402H24Rik
Ensembl Gene ENSMUSG00000027309
Gene NameRIKEN cDNA 4930402H24 gene
Synonyms
MMRRC Submission 040353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2374 (G1)
Quality Score208
Status Validated
Chromosome2
Chromosomal Location130706200-130906406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130820574 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 60 (Y60H)
Ref Sequence ENSEMBL: ENSMUSP00000046992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044766] [ENSMUST00000110243] [ENSMUST00000119422] [ENSMUST00000120316] [ENSMUST00000138990] [ENSMUST00000146975]
Predicted Effect probably damaging
Transcript: ENSMUST00000044766
AA Change: Y60H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046992
Gene: ENSMUSG00000027309
AA Change: Y60H

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 463 473 N/A INTRINSIC
low complexity region 533 545 N/A INTRINSIC
coiled coil region 1143 1171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110243
AA Change: Y60H

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105872
Gene: ENSMUSG00000027309
AA Change: Y60H

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119422
SMART Domains Protein: ENSMUSP00000113481
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 332 342 N/A INTRINSIC
low complexity region 402 414 N/A INTRINSIC
coiled coil region 1012 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120316
SMART Domains Protein: ENSMUSP00000112540
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144014
Predicted Effect probably benign
Transcript: ENSMUST00000146975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148924
Meta Mutation Damage Score 0.3062 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an uncharacterized protein with a C-terminal coiled-coil region. The gene is located on chromosome 20p13 in a 1.8 Mb region linked to a spinocerebellar ataxia phenotype, but this gene does not appear to be a disease candidate. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Clec4b1 T G 6: 123,050,638 L18R probably damaging Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Ly6e A G 15: 74,958,621 S107G probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr1272 A T 2: 90,282,451 S41R possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tbc1d12 T A 19: 38,837,170 L155Q possibly damaging Het
Tnni3k A T 3: 154,786,785 M816K probably benign Het
Ugt2a3 T C 5: 87,327,191 D398G probably damaging Het
Vmn1r25 A T 6: 57,978,558 S249T probably benign Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zbtb26 A G 2: 37,436,485 S180P probably benign Het
Zfy1 A T Y: 726,391 L458Q probably damaging Het
Zfy1 G C Y: 726,392 L458V possibly damaging Het
Zmpste24 T C 4: 121,074,537 E297G probably benign Het
Other mutations in 4930402H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:4930402H24Rik APN 2 130784457 missense probably benign 0.00
IGL01093:4930402H24Rik APN 2 130777236 missense probably benign 0.01
IGL01111:4930402H24Rik APN 2 130736598 missense possibly damaging 0.66
IGL01146:4930402H24Rik APN 2 130770671 critical splice donor site probably null
IGL01346:4930402H24Rik APN 2 130791846 splice site probably benign
IGL01548:4930402H24Rik APN 2 130814259 missense probably damaging 1.00
IGL02339:4930402H24Rik APN 2 130739465 missense probably damaging 0.97
IGL02637:4930402H24Rik APN 2 130814307 intron probably benign
IGL02926:4930402H24Rik APN 2 130712366 missense probably benign 0.00
IGL02978:4930402H24Rik APN 2 130727162 missense probably damaging 0.99
IGL03126:4930402H24Rik APN 2 130791995 splice site probably null
IGL03387:4930402H24Rik APN 2 130717280 missense probably damaging 1.00
best_times UTSW 2 130736576 missense probably damaging 0.99
Hard_times UTSW 2 130713470 missense probably benign 0.16
worst_times UTSW 2 130713414 missense probably damaging 1.00
FR4304:4930402H24Rik UTSW 2 130770748 small insertion probably benign
FR4342:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770745 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4737:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770739 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770753 small insertion probably benign
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0357:4930402H24Rik UTSW 2 130712946 splice site probably benign
R0379:4930402H24Rik UTSW 2 130785546 splice site probably benign
R0515:4930402H24Rik UTSW 2 130740488 missense probably damaging 1.00
R0576:4930402H24Rik UTSW 2 130713470 missense probably benign 0.16
R0811:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R0812:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R1334:4930402H24Rik UTSW 2 130775722 splice site probably null
R1485:4930402H24Rik UTSW 2 130748683 critical splice donor site probably null
R1486:4930402H24Rik UTSW 2 130737418 missense probably damaging 1.00
R1670:4930402H24Rik UTSW 2 130712379 missense probably damaging 1.00
R1678:4930402H24Rik UTSW 2 130814273 missense probably damaging 0.99
R1700:4930402H24Rik UTSW 2 130709938 missense probably damaging 0.99
R1742:4930402H24Rik UTSW 2 130740395 splice site probably null
R2046:4930402H24Rik UTSW 2 130810917 missense possibly damaging 0.61
R3878:4930402H24Rik UTSW 2 130778503 missense possibly damaging 0.92
R3907:4930402H24Rik UTSW 2 130736576 missense probably damaging 0.99
R4467:4930402H24Rik UTSW 2 130767647 missense probably damaging 0.96
R4931:4930402H24Rik UTSW 2 130741873 missense possibly damaging 0.58
R5098:4930402H24Rik UTSW 2 130798181 missense probably damaging 0.99
R5191:4930402H24Rik UTSW 2 130737403 missense possibly damaging 0.68
R5313:4930402H24Rik UTSW 2 130709268 missense probably damaging 1.00
R5405:4930402H24Rik UTSW 2 130712460 missense probably damaging 1.00
R5436:4930402H24Rik UTSW 2 130764499 missense probably benign 0.16
R5522:4930402H24Rik UTSW 2 130814302 intron probably benign
R5783:4930402H24Rik UTSW 2 130739083 missense possibly damaging 0.59
R5931:4930402H24Rik UTSW 2 130814189 missense probably damaging 1.00
R6145:4930402H24Rik UTSW 2 130778473 missense probably benign
R6732:4930402H24Rik UTSW 2 130810820 critical splice donor site probably null
R6938:4930402H24Rik UTSW 2 130775753 missense probably benign 0.00
R7161:4930402H24Rik UTSW 2 130806788 missense unknown
R7193:4930402H24Rik UTSW 2 130806788 missense unknown
R7194:4930402H24Rik UTSW 2 130806788 missense unknown
R7233:4930402H24Rik UTSW 2 130806788 missense unknown
R7234:4930402H24Rik UTSW 2 130806788 missense unknown
R7238:4930402H24Rik UTSW 2 130806788 missense unknown
R7239:4930402H24Rik UTSW 2 130806788 missense unknown
R7268:4930402H24Rik UTSW 2 130806788 missense unknown
R7807:4930402H24Rik UTSW 2 130710865 missense probably damaging 1.00
R7904:4930402H24Rik UTSW 2 130792003 splice site probably null
R7999:4930402H24Rik UTSW 2 130737452 missense probably benign 0.00
R8047:4930402H24Rik UTSW 2 130775099 missense probably damaging 0.98
R8286:4930402H24Rik UTSW 2 130717328 missense probably damaging 1.00
R8315:4930402H24Rik UTSW 2 130770735 small deletion probably benign
R8439:4930402H24Rik UTSW 2 130770701 missense probably damaging 1.00
RF027:4930402H24Rik UTSW 2 130770744 small insertion probably benign
RF038:4930402H24Rik UTSW 2 130770744 nonsense probably null
RF046:4930402H24Rik UTSW 2 130770734 nonsense probably null
RF048:4930402H24Rik UTSW 2 130770734 nonsense probably null
Z1177:4930402H24Rik UTSW 2 130710867 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCTTTGGACTATTTAAATTCTGCT -3'
(R):5'- CCAAGGAAGGTACCTTATGCC -3'

Sequencing Primer
(F):5'- TTAATTCCAGCACTCGGGAG -3'
(R):5'- AGGAAGGTACCTTATGCCTCAGC -3'
Posted On2014-11-11