Incidental Mutation 'R2374:Tnni3k'
ID248224
Institutional Source Beutler Lab
Gene Symbol Tnni3k
Ensembl Gene ENSMUSG00000040086
Gene NameTNNI3 interacting kinase
SynonymsCark, D830019J24Rik
MMRRC Submission 040353-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R2374 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location154786291-155055407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154786785 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 816 (M816K)
Ref Sequence ENSEMBL: ENSMUSP00000070561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064076] [ENSMUST00000143410]
Predicted Effect probably benign
Transcript: ENSMUST00000064076
AA Change: M816K

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000070561
Gene: ENSMUSG00000040086
AA Change: M816K

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 718 6.7e-48 PFAM
Pfam:Pkinase_Tyr 462 718 2.1e-59 PFAM
low complexity region 727 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143410
SMART Domains Protein: ENSMUSP00000122478
Gene: ENSMUSG00000040086

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 674 3.5e-48 PFAM
Pfam:Pkinase_Tyr 462 674 3.6e-52 PFAM
Meta Mutation Damage Score 0.1091 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the MAP kinase kinase kinase (MAPKKK) family of protein kinases. The protein contains ankyrin repeat, protein kinase and serine-rich domains and is thought to play a role in cardiac physiology. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac myocytes exhibit decreased response to cardiac ischemic/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,820,574 Y60H probably damaging Het
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Clec4b1 T G 6: 123,050,638 L18R probably damaging Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Ly6e A G 15: 74,958,621 S107G probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr1272 A T 2: 90,282,451 S41R possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tbc1d12 T A 19: 38,837,170 L155Q possibly damaging Het
Ugt2a3 T C 5: 87,327,191 D398G probably damaging Het
Vmn1r25 A T 6: 57,978,558 S249T probably benign Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zbtb26 A G 2: 37,436,485 S180P probably benign Het
Zfy1 G C Y: 726,392 L458V possibly damaging Het
Zfy1 A T Y: 726,391 L458Q probably damaging Het
Zmpste24 T C 4: 121,074,537 E297G probably benign Het
Other mutations in Tnni3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Tnni3k APN 3 155054555 missense probably benign 0.00
IGL00852:Tnni3k APN 3 155054569 missense probably benign 0.00
IGL01090:Tnni3k APN 3 154939683 missense possibly damaging 0.69
IGL01593:Tnni3k APN 3 154941029 splice site probably null
IGL01724:Tnni3k APN 3 154939626 missense possibly damaging 0.53
IGL01887:Tnni3k APN 3 154875187 splice site probably null
IGL01992:Tnni3k APN 3 154962026 missense probably damaging 0.99
IGL02945:Tnni3k APN 3 155037438 missense possibly damaging 0.48
IGL02990:Tnni3k APN 3 154957758 missense probably benign 0.01
IGL03069:Tnni3k APN 3 154941605 splice site probably null
IGL03325:Tnni3k APN 3 154961814 missense probably damaging 1.00
IGL03405:Tnni3k APN 3 154792767 splice site probably benign
R0211:Tnni3k UTSW 3 155055344 start gained probably benign
R0682:Tnni3k UTSW 3 154940028 missense probably damaging 1.00
R0693:Tnni3k UTSW 3 154961972 missense probably damaging 1.00
R0907:Tnni3k UTSW 3 154941679 missense probably damaging 1.00
R1109:Tnni3k UTSW 3 154792777 missense possibly damaging 0.83
R1180:Tnni3k UTSW 3 154875513 missense probably damaging 1.00
R1181:Tnni3k UTSW 3 154875513 missense probably damaging 1.00
R1476:Tnni3k UTSW 3 155030305 missense probably benign 0.05
R1496:Tnni3k UTSW 3 154939658 missense probably damaging 1.00
R1687:Tnni3k UTSW 3 154939626 missense possibly damaging 0.53
R1704:Tnni3k UTSW 3 154827508 missense probably benign 0.27
R1913:Tnni3k UTSW 3 154979199 missense probably benign 0.00
R2343:Tnni3k UTSW 3 154938829 missense probably benign 0.00
R2869:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2869:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2871:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2871:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2872:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2872:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2873:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R4858:Tnni3k UTSW 3 154786808 splice site probably null
R5597:Tnni3k UTSW 3 154872128 missense probably damaging 1.00
R5806:Tnni3k UTSW 3 154827611 missense possibly damaging 0.88
R5871:Tnni3k UTSW 3 155030370 missense probably benign 0.23
R6467:Tnni3k UTSW 3 154969285 missense probably damaging 0.97
R6475:Tnni3k UTSW 3 154941058 nonsense probably null
R6882:Tnni3k UTSW 3 154957720 missense possibly damaging 0.49
R6976:Tnni3k UTSW 3 154792776 missense probably benign 0.14
R6986:Tnni3k UTSW 3 154961864 missense probably damaging 1.00
R7207:Tnni3k UTSW 3 154875145 missense probably damaging 1.00
R7539:Tnni3k UTSW 3 154962031 missense probably benign 0.01
R7843:Tnni3k UTSW 3 155038524 missense probably damaging 0.98
R8546:Tnni3k UTSW 3 154792807 missense probably benign
R8787:Tnni3k UTSW 3 154940054 missense probably damaging 0.99
Z1088:Tnni3k UTSW 3 154939670 missense probably damaging 1.00
Z1176:Tnni3k UTSW 3 155038557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTACGTGAGCGCAGAATAAGC -3'
(R):5'- GGCATCAACTCCATGCTTCC -3'

Sequencing Primer
(F):5'- CGTGAGCGCAGAATAAGCAAGAC -3'
(R):5'- CCATTTTAAATCTTAGCATCCCCAAG -3'
Posted On2014-11-11