Incidental Mutation 'R2374:Zmpste24'
ID248225
Institutional Source Beutler Lab
Gene Symbol Zmpste24
Ensembl Gene ENSMUSG00000043207
Gene Namezinc metallopeptidase, STE24
SynonymsA530043O15Rik
MMRRC Submission 040353-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R2374 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location121059237-121098241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121074537 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 297 (E297G)
Ref Sequence ENSEMBL: ENSMUSP00000053900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058754]
Predicted Effect probably benign
Transcript: ENSMUST00000058754
AA Change: E297G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207
AA Change: E297G

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157689
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M48A family. The encoded protein is a zinc metalloproteinase involved in the two step post-translational proteolytic cleavage of carboxy terminal residues of farnesylated prelamin A to form mature lamin A. Mutations in this gene have been associated with mandibuloacral dysplasia and restrictive dermopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are deficient in proteolytic processing of prelamin A and display many abnormalities including retarded growth, bone fragility, hair loss, cardiomyopathy, muscular dystrophy and lipodystrophy. Most die prematurely, but some survive and reproduce. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,820,574 Y60H probably damaging Het
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Clec4b1 T G 6: 123,050,638 L18R probably damaging Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Ly6e A G 15: 74,958,621 S107G probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr1272 A T 2: 90,282,451 S41R possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tbc1d12 T A 19: 38,837,170 L155Q possibly damaging Het
Tnni3k A T 3: 154,786,785 M816K probably benign Het
Ugt2a3 T C 5: 87,327,191 D398G probably damaging Het
Vmn1r25 A T 6: 57,978,558 S249T probably benign Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zbtb26 A G 2: 37,436,485 S180P probably benign Het
Zfy1 G C Y: 726,392 L458V possibly damaging Het
Zfy1 A T Y: 726,391 L458Q probably damaging Het
Other mutations in Zmpste24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Zmpste24 APN 4 121082815 unclassified probably benign
IGL00672:Zmpste24 APN 4 121065860 missense probably damaging 1.00
IGL00828:Zmpste24 APN 4 121074520 missense possibly damaging 0.66
IGL01731:Zmpste24 APN 4 121097884 missense probably benign
IGL01738:Zmpste24 APN 4 121061111 missense probably damaging 1.00
IGL02668:Zmpste24 APN 4 121061100 missense probably damaging 1.00
R0097:Zmpste24 UTSW 4 121095543 splice site probably benign
R0097:Zmpste24 UTSW 4 121095543 splice site probably benign
R0226:Zmpste24 UTSW 4 121081209 missense probably benign 0.00
R0277:Zmpste24 UTSW 4 121082853 missense probably damaging 1.00
R0323:Zmpste24 UTSW 4 121082853 missense probably damaging 1.00
R1822:Zmpste24 UTSW 4 121087316 missense possibly damaging 0.78
R2233:Zmpste24 UTSW 4 121097965 missense probably benign 0.05
R3683:Zmpste24 UTSW 4 121061091 missense probably damaging 1.00
R4810:Zmpste24 UTSW 4 121061054 missense probably damaging 1.00
R5169:Zmpste24 UTSW 4 121068717 missense probably damaging 1.00
R5650:Zmpste24 UTSW 4 121082877 missense possibly damaging 0.67
R5709:Zmpste24 UTSW 4 121065878 missense probably benign
R6429:Zmpste24 UTSW 4 121095670 missense probably damaging 0.99
R7165:Zmpste24 UTSW 4 121082894 missense probably null 1.00
R7353:Zmpste24 UTSW 4 121095581 missense probably damaging 1.00
R7498:Zmpste24 UTSW 4 121082831 missense probably benign 0.00
R8416:Zmpste24 UTSW 4 121083359 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ACAGCAGCACCTTAAGAGTTG -3'
(R):5'- ATTGCTACACACCAGGGAGC -3'

Sequencing Primer
(F):5'- CAGCAGCACCTTAAGAGTTGTAGTG -3'
(R):5'- ACAGCCTTTCAGTGTTAATGC -3'
Posted On2014-11-11