Incidental Mutation 'R2374:Vmn1r25'
ID248229
Institutional Source Beutler Lab
Gene Symbol Vmn1r25
Ensembl Gene ENSMUSG00000115668
Gene Namevomeronasal 1 receptor 25
SynonymsV1rc8
MMRRC Submission 040353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2374 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location57978299-57980810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57978558 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 249 (S249T)
Ref Sequence ENSEMBL: ENSMUSP00000154074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176572] [ENSMUST00000228585]
Predicted Effect probably benign
Transcript: ENSMUST00000176572
AA Change: S249T

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135860
Gene: ENSMUSG00000115668
AA Change: S249T

DomainStartEndE-ValueType
Pfam:V1R 29 293 5.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228585
AA Change: S249T

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,820,574 Y60H probably damaging Het
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Clec4b1 T G 6: 123,050,638 L18R probably damaging Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Ly6e A G 15: 74,958,621 S107G probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr1272 A T 2: 90,282,451 S41R possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tbc1d12 T A 19: 38,837,170 L155Q possibly damaging Het
Tnni3k A T 3: 154,786,785 M816K probably benign Het
Ugt2a3 T C 5: 87,327,191 D398G probably damaging Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zbtb26 A G 2: 37,436,485 S180P probably benign Het
Zfy1 A T Y: 726,391 L458Q probably damaging Het
Zfy1 G C Y: 726,392 L458V possibly damaging Het
Zmpste24 T C 4: 121,074,537 E297G probably benign Het
Other mutations in Vmn1r25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Vmn1r25 APN 6 57979211 missense probably damaging 0.99
R0299:Vmn1r25 UTSW 6 57978509 missense probably damaging 1.00
R0401:Vmn1r25 UTSW 6 57978711 missense probably benign 0.01
R0499:Vmn1r25 UTSW 6 57978509 missense probably damaging 1.00
R1294:Vmn1r25 UTSW 6 57978479 missense possibly damaging 0.55
R1562:Vmn1r25 UTSW 6 57978801 missense probably benign 0.03
R1661:Vmn1r25 UTSW 6 57978461 missense probably damaging 1.00
R1665:Vmn1r25 UTSW 6 57978461 missense probably damaging 1.00
R1879:Vmn1r25 UTSW 6 57978927 missense possibly damaging 0.50
R2221:Vmn1r25 UTSW 6 57979238 missense probably damaging 1.00
R2223:Vmn1r25 UTSW 6 57979238 missense probably damaging 1.00
R4073:Vmn1r25 UTSW 6 57978587 missense possibly damaging 0.94
R4398:Vmn1r25 UTSW 6 57978827 missense probably damaging 1.00
R4590:Vmn1r25 UTSW 6 57978495 missense probably benign 0.02
R4779:Vmn1r25 UTSW 6 57979026 missense probably damaging 0.98
R5397:Vmn1r25 UTSW 6 57979075 nonsense probably null
R6113:Vmn1r25 UTSW 6 57978572 missense probably benign 0.00
R6858:Vmn1r25 UTSW 6 57979011 missense probably benign 0.22
R7407:Vmn1r25 UTSW 6 57979059 missense possibly damaging 0.76
R7748:Vmn1r25 UTSW 6 57978564 missense probably damaging 1.00
R8001:Vmn1r25 UTSW 6 57979080 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTTTGCCCCTTGACAATTAAAG -3'
(R):5'- GGAGTCATGCTGATCACAAATG -3'

Sequencing Primer
(F):5'- TTGAAACTCCAGTTCCAGGGGATC -3'
(R):5'- TGCTGATCACAAATGCATATATAGTG -3'
Posted On2014-11-11