Incidental Mutation 'R2374:Clec4b1'
ID248231
Institutional Source Beutler Lab
Gene Symbol Clec4b1
Ensembl Gene ENSMUSG00000030147
Gene NameC-type lectin domain family 4, member b1
SynonymsmDcar2, 1810046I24Rik, DCAR, 1810046I24Rik, DCARbeta
MMRRC Submission 040353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R2374 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123049962-123071555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 123050638 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 18 (L18R)
Ref Sequence ENSEMBL: ENSMUSP00000077636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077228] [ENSMUST00000078559]
Predicted Effect probably damaging
Transcript: ENSMUST00000077228
AA Change: L18R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076466
Gene: ENSMUSG00000030147
AA Change: L18R

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 45 170 2.95e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078559
AA Change: L18R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077636
Gene: ENSMUSG00000030147
AA Change: L18R

DomainStartEndE-ValueType
Blast:CLECT 26 71 1e-9 BLAST
CLECT 78 203 2.95e-31 SMART
Meta Mutation Damage Score 0.2087 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in dendritic cell function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,820,574 Y60H probably damaging Het
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Ly6e A G 15: 74,958,621 S107G probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr1272 A T 2: 90,282,451 S41R possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tbc1d12 T A 19: 38,837,170 L155Q possibly damaging Het
Tnni3k A T 3: 154,786,785 M816K probably benign Het
Ugt2a3 T C 5: 87,327,191 D398G probably damaging Het
Vmn1r25 A T 6: 57,978,558 S249T probably benign Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zbtb26 A G 2: 37,436,485 S180P probably benign Het
Zfy1 A T Y: 726,391 L458Q probably damaging Het
Zfy1 G C Y: 726,392 L458V possibly damaging Het
Zmpste24 T C 4: 121,074,537 E297G probably benign Het
Other mutations in Clec4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02817:Clec4b1 APN 6 123068485 missense possibly damaging 0.83
R0488:Clec4b1 UTSW 6 123071482 missense probably damaging 0.99
R0526:Clec4b1 UTSW 6 123069770 critical splice donor site probably null
R0675:Clec4b1 UTSW 6 123071446 missense probably damaging 0.99
R2504:Clec4b1 UTSW 6 123065945 missense probably damaging 0.98
R3609:Clec4b1 UTSW 6 123050632 missense probably damaging 0.99
R4062:Clec4b1 UTSW 6 123068484 missense probably benign 0.03
R4081:Clec4b1 UTSW 6 123069774 splice site probably null
R4865:Clec4b1 UTSW 6 123068469 missense possibly damaging 0.84
R5172:Clec4b1 UTSW 6 123071455 missense probably benign 0.34
R5204:Clec4b1 UTSW 6 123071535 makesense probably null
R5757:Clec4b1 UTSW 6 123069754 nonsense probably null
R6129:Clec4b1 UTSW 6 123068502 missense possibly damaging 0.50
R7598:Clec4b1 UTSW 6 123071468 nonsense probably null
R8337:Clec4b1 UTSW 6 123065963 missense probably benign 0.08
R8362:Clec4b1 UTSW 6 123050643 missense probably benign 0.00
Z1188:Clec4b1 UTSW 6 123050046 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATCCTAGGATGTTGACAGCAC -3'
(R):5'- TTGCATGCAAGACTGGACC -3'

Sequencing Primer
(F):5'- ATTCTGAGCATTTTGTCTGG -3'
(R):5'- CCTGGTCCATGCAGAAAGTTTCAG -3'
Posted On2014-11-11