Mutagenetix > Incidental Mutation

Incidental Mutation 'R2374:Grid1'

248241

Institutional Source

Beutler Lab

Gene Symbol

Grid1

Ensembl Gene

ENSMUSG00000041078

Gene Name

glutamate receptor, ionotropic, delta 1

Synonyms

GluRdelta1

MMRRC Submission

040353-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R2374 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34820108-35583379 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 35321807 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000044009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043349]

AlphaFold

Q61627

Predicted Effect

probably benign
Transcript: ENSMUST00000043349

SMART Domains

Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	36	400	4.1e-51	PFAM
PBPe	438	807	4.68e-110	SMART
Lig_chan-Glu_bd	448	510	8.18e-25	SMART
low complexity region	838	853	N/A	INTRINSIC
low complexity region	943	958	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 92.7%

Validation Efficiency

97% (33/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,820,574	Y60H	probably damaging	Het
4932438A13Rik	A	G	3: 36,885,396	D133G	probably benign	Het
Adnp2	C	T	18: 80,130,987	R69Q	probably damaging	Het
Celsr3	G	A	9: 108,842,552	R2450H	probably benign	Het
Clec4b1	T	G	6: 123,050,638	L18R	probably damaging	Het
Cntrl	G	A	2: 35,153,276	V706I	possibly damaging	Het
Dhx30	A	G	9: 110,091,564	L294P	probably damaging	Het
Dysf	T	C	6: 84,097,729	L504P	probably damaging	Het
Gm10754	A	G	10: 97,682,151		probably benign	Het
Hydin	A	G	8: 110,565,148	N3424S	probably damaging	Het
Itgb2	G	A	10: 77,559,681	V539I	probably benign	Het
Itgb5	T	A	16: 33,919,798	V426E	probably damaging	Het
Ly6e	A	G	15: 74,958,621	S107G	probably damaging	Het
Mc3r	G	A	2: 172,249,154	A99T	possibly damaging	Het
Myo15	T	G	11: 60,478,843	S810A	possibly damaging	Het
Neb	A	G	2: 52,263,657	W2419R	probably damaging	Het
Nkpd1	A	T	7: 19,523,975	T560S	possibly damaging	Het
Olfr1272	A	T	2: 90,282,451	S41R	possibly damaging	Het
Olfr135	T	C	17: 38,209,067	M274T	probably damaging	Het
Rasa3	A	G	8: 13,577,411	L697P	probably damaging	Het
Sptbn4	A	G	7: 27,360,092	Y2443H	probably damaging	Het
Steap2	A	G	5: 5,675,845	I393T	probably damaging	Het
Tbc1d12	T	A	19: 38,837,170	L155Q	possibly damaging	Het
Tnni3k	A	T	3: 154,786,785	M816K	probably benign	Het
Ugt2a3	T	C	5: 87,327,191	D398G	probably damaging	Het
Vmn1r25	A	T	6: 57,978,558	S249T	probably benign	Het
Vmn2r17	C	A	5: 109,427,238	P137Q	probably benign	Het
Zbtb26	A	G	2: 37,436,485	S180P	probably benign	Het
Zfy1	A	T	Y: 726,391	L458Q	probably damaging	Het
Zfy1	G	C	Y: 726,392	L458V	possibly damaging	Het
Zmpste24	T	C	4: 121,074,537	E297G	probably benign	Het

Other mutations in Grid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00705:Grid1	APN	14	35445887	missense	possibly damaging	0.70
IGL01016:Grid1	APN	14	34822639	nonsense	probably null
IGL01643:Grid1	APN	14	35323435	critical splice donor site	probably null
IGL01697:Grid1	APN	14	35309257	missense	probably benign	0.21
IGL01879:Grid1	APN	14	35450370	missense	possibly damaging	0.93
IGL01975:Grid1	APN	14	35323426	missense	probably benign
IGL02515:Grid1	APN	14	35452345	missense	probably damaging	0.99
IGL02935:Grid1	APN	14	34822558	missense	possibly damaging	0.86
IGL03279:Grid1	APN	14	34945765	missense	probably damaging	0.98
IGL03286:Grid1	APN	14	35520685	splice site	probably benign
IGL03296:Grid1	APN	14	35580567	missense	possibly damaging	0.52
IGL03305:Grid1	APN	14	35251707	missense	probably damaging	1.00
R0533:Grid1	UTSW	14	35309385	missense	possibly damaging	0.84
R0746:Grid1	UTSW	14	34822690	missense	possibly damaging	0.92
R0811:Grid1	UTSW	14	34822619	missense	probably benign
R0812:Grid1	UTSW	14	34822619	missense	probably benign
R1144:Grid1	UTSW	14	35562676	splice site	probably benign
R1217:Grid1	UTSW	14	34820229	start codon destroyed	probably null	0.53
R1485:Grid1	UTSW	14	34822583	missense	probably damaging	1.00
R1529:Grid1	UTSW	14	35309293	missense	probably benign	0.36
R1606:Grid1	UTSW	14	35445965	missense	probably damaging	0.96
R1691:Grid1	UTSW	14	35452329	missense	probably damaging	1.00
R1759:Grid1	UTSW	14	35446031	missense	possibly damaging	0.92
R2415:Grid1	UTSW	14	35450369	missense	possibly damaging	0.69
R2866:Grid1	UTSW	14	35562559	missense	probably damaging	1.00
R3915:Grid1	UTSW	14	35520727	missense	probably damaging	1.00
R4044:Grid1	UTSW	14	35450401	splice site	probably benign
R4364:Grid1	UTSW	14	34946032	missense	probably benign	0.20
R4691:Grid1	UTSW	14	35569557	missense	probably benign
R4694:Grid1	UTSW	14	35026780	missense	probably damaging	1.00
R4749:Grid1	UTSW	14	35580687	missense	possibly damaging	0.50
R4794:Grid1	UTSW	14	34822622	missense	probably damaging	0.99
R4854:Grid1	UTSW	14	35321641	missense	probably benign
R5555:Grid1	UTSW	14	35520705	missense	possibly damaging	0.92
R6005:Grid1	UTSW	14	35323412	missense	probably damaging	1.00
R6176:Grid1	UTSW	14	35562547	missense	probably benign	0.00
R6569:Grid1	UTSW	14	35323339	missense	possibly damaging	0.72
R6911:Grid1	UTSW	14	34820228	start codon destroyed	probably benign	0.08
R7504:Grid1	UTSW	14	35562513	missense	probably damaging	1.00
R7744:Grid1	UTSW	14	35450079	missense	probably damaging	1.00
R7795:Grid1	UTSW	14	35321685	missense	probably damaging	1.00
R7883:Grid1	UTSW	14	35450302	splice site	probably null
R7913:Grid1	UTSW	14	35569697	missense	probably damaging	0.99
R8032:Grid1	UTSW	14	35323359	missense	probably benign	0.00
R8333:Grid1	UTSW	14	35569638	missense	possibly damaging	0.82
R8916:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8928:Grid1	UTSW	14	35580766	missense	probably benign	0.25
R8934:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8935:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8939:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8986:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8993:Grid1	UTSW	14	35026942	missense	probably benign	0.00
R9238:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9310:Grid1	UTSW	14	35026805	missense	probably damaging	1.00
R9332:Grid1	UTSW	14	35323403	missense	probably benign	0.06
R9335:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9336:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9478:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9479:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9496:Grid1	UTSW	14	35569614	missense	probably damaging	1.00
R9583:Grid1	UTSW	14	35580535	missense	possibly damaging	0.90
R9601:Grid1	UTSW	14	35445857	missense	probably damaging	0.99
R9734:Grid1	UTSW	14	35580785	missense	probably benign
U24488:Grid1	UTSW	14	35580577	missense	probably benign	0.00
Z1088:Grid1	UTSW	14	35452294	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAAGATTTGCGCTTTTCTGTC -3'
(R):5'- GACCCTGGACATCAATTCACTC -3'

Sequencing Primer
(F):5'- GTCTTTGTAGATCTCCAATCTCTACC -3'
(R):5'- GACTTAGGTAGTCGCTCACAAATAC -3'

Posted On

2014-11-11