Incidental Mutation 'R2374:Grid1'
ID 248241
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Name glutamate receptor, ionotropic, delta 1
Synonyms GluRdelta1
MMRRC Submission 040353-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R2374 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 34542065-35305336 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 35043764 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
AlphaFold Q61627
Predicted Effect probably benign
Transcript: ENSMUST00000043349
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 C T 18: 80,174,202 (GRCm39) R69Q probably damaging Het
Bltp1 A G 3: 36,939,545 (GRCm39) D133G probably benign Het
Celsr3 G A 9: 108,719,751 (GRCm39) R2450H probably benign Het
Clec4b1 T G 6: 123,027,597 (GRCm39) L18R probably damaging Het
Cntrl G A 2: 35,043,288 (GRCm39) V706I possibly damaging Het
Dhx30 A G 9: 109,920,632 (GRCm39) L294P probably damaging Het
Dnaaf9 A G 2: 130,662,494 (GRCm39) Y60H probably damaging Het
Dysf T C 6: 84,074,711 (GRCm39) L504P probably damaging Het
Gm10754 A G 10: 97,518,013 (GRCm39) probably benign Het
Hydin A G 8: 111,291,780 (GRCm39) N3424S probably damaging Het
Itgb2 G A 10: 77,395,515 (GRCm39) V539I probably benign Het
Itgb5 T A 16: 33,740,168 (GRCm39) V426E probably damaging Het
Ly6e A G 15: 74,830,470 (GRCm39) S107G probably damaging Het
Mc3r G A 2: 172,091,074 (GRCm39) A99T possibly damaging Het
Myo15a T G 11: 60,369,669 (GRCm39) S810A possibly damaging Het
Neb A G 2: 52,153,669 (GRCm39) W2419R probably damaging Het
Nkpd1 A T 7: 19,257,900 (GRCm39) T560S possibly damaging Het
Or2n1c T C 17: 38,519,958 (GRCm39) M274T probably damaging Het
Or4b1b A T 2: 90,112,795 (GRCm39) S41R possibly damaging Het
Rasa3 A G 8: 13,627,411 (GRCm39) L697P probably damaging Het
Sptbn4 A G 7: 27,059,517 (GRCm39) Y2443H probably damaging Het
Steap2 A G 5: 5,725,845 (GRCm39) I393T probably damaging Het
Tbc1d12 T A 19: 38,825,614 (GRCm39) L155Q possibly damaging Het
Tnni3k A T 3: 154,492,422 (GRCm39) M816K probably benign Het
Ugt2a3 T C 5: 87,475,050 (GRCm39) D398G probably damaging Het
Vmn1r25 A T 6: 57,955,543 (GRCm39) S249T probably benign Het
Vmn2r17 C A 5: 109,575,104 (GRCm39) P137Q probably benign Het
Zbtb26 A G 2: 37,326,497 (GRCm39) S180P probably benign Het
Zfy1 A T Y: 726,391 (GRCm39) L458Q probably damaging Het
Zfy1 G C Y: 726,392 (GRCm39) L458V possibly damaging Het
Zmpste24 T C 4: 120,931,734 (GRCm39) E297G probably benign Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35,167,844 (GRCm39) missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34,544,596 (GRCm39) nonsense probably null
IGL01643:Grid1 APN 14 35,045,392 (GRCm39) critical splice donor site probably null
IGL01697:Grid1 APN 14 35,031,214 (GRCm39) missense probably benign 0.21
IGL01879:Grid1 APN 14 35,172,327 (GRCm39) missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35,045,383 (GRCm39) missense probably benign
IGL02515:Grid1 APN 14 35,174,302 (GRCm39) missense probably damaging 0.99
IGL02935:Grid1 APN 14 34,544,515 (GRCm39) missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34,667,722 (GRCm39) missense probably damaging 0.98
IGL03286:Grid1 APN 14 35,242,642 (GRCm39) splice site probably benign
IGL03296:Grid1 APN 14 35,302,524 (GRCm39) missense possibly damaging 0.52
IGL03305:Grid1 APN 14 34,973,664 (GRCm39) missense probably damaging 1.00
R0533:Grid1 UTSW 14 35,031,342 (GRCm39) missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34,544,647 (GRCm39) missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34,544,576 (GRCm39) missense probably benign
R0812:Grid1 UTSW 14 34,544,576 (GRCm39) missense probably benign
R1144:Grid1 UTSW 14 35,284,633 (GRCm39) splice site probably benign
R1217:Grid1 UTSW 14 34,542,186 (GRCm39) start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34,544,540 (GRCm39) missense probably damaging 1.00
R1529:Grid1 UTSW 14 35,031,250 (GRCm39) missense probably benign 0.36
R1606:Grid1 UTSW 14 35,167,922 (GRCm39) missense probably damaging 0.96
R1691:Grid1 UTSW 14 35,174,286 (GRCm39) missense probably damaging 1.00
R1759:Grid1 UTSW 14 35,167,988 (GRCm39) missense possibly damaging 0.92
R2415:Grid1 UTSW 14 35,172,326 (GRCm39) missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35,284,516 (GRCm39) missense probably damaging 1.00
R3915:Grid1 UTSW 14 35,242,684 (GRCm39) missense probably damaging 1.00
R4044:Grid1 UTSW 14 35,172,358 (GRCm39) splice site probably benign
R4364:Grid1 UTSW 14 34,667,989 (GRCm39) missense probably benign 0.20
R4691:Grid1 UTSW 14 35,291,514 (GRCm39) missense probably benign
R4694:Grid1 UTSW 14 34,748,737 (GRCm39) missense probably damaging 1.00
R4749:Grid1 UTSW 14 35,302,644 (GRCm39) missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34,544,579 (GRCm39) missense probably damaging 0.99
R4854:Grid1 UTSW 14 35,043,598 (GRCm39) missense probably benign
R5555:Grid1 UTSW 14 35,242,662 (GRCm39) missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35,045,369 (GRCm39) missense probably damaging 1.00
R6176:Grid1 UTSW 14 35,284,504 (GRCm39) missense probably benign 0.00
R6569:Grid1 UTSW 14 35,045,296 (GRCm39) missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34,542,185 (GRCm39) start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35,284,470 (GRCm39) missense probably damaging 1.00
R7744:Grid1 UTSW 14 35,172,036 (GRCm39) missense probably damaging 1.00
R7795:Grid1 UTSW 14 35,043,642 (GRCm39) missense probably damaging 1.00
R7883:Grid1 UTSW 14 35,172,259 (GRCm39) splice site probably null
R7913:Grid1 UTSW 14 35,291,654 (GRCm39) missense probably damaging 0.99
R8032:Grid1 UTSW 14 35,045,316 (GRCm39) missense probably benign 0.00
R8333:Grid1 UTSW 14 35,291,595 (GRCm39) missense possibly damaging 0.82
R8916:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R8928:Grid1 UTSW 14 35,302,723 (GRCm39) missense probably benign 0.25
R8934:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R8935:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R8939:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R8986:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R8993:Grid1 UTSW 14 34,748,899 (GRCm39) missense probably benign 0.00
R9238:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R9310:Grid1 UTSW 14 34,748,762 (GRCm39) missense probably damaging 1.00
R9332:Grid1 UTSW 14 35,045,360 (GRCm39) missense probably benign 0.06
R9335:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R9336:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R9478:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R9479:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R9496:Grid1 UTSW 14 35,291,571 (GRCm39) missense probably damaging 1.00
R9583:Grid1 UTSW 14 35,302,492 (GRCm39) missense possibly damaging 0.90
R9601:Grid1 UTSW 14 35,167,814 (GRCm39) missense probably damaging 0.99
R9734:Grid1 UTSW 14 35,302,742 (GRCm39) missense probably benign
U24488:Grid1 UTSW 14 35,302,534 (GRCm39) missense probably benign 0.00
Z1088:Grid1 UTSW 14 35,174,251 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGATTTGCGCTTTTCTGTC -3'
(R):5'- GACCCTGGACATCAATTCACTC -3'

Sequencing Primer
(F):5'- GTCTTTGTAGATCTCCAATCTCTACC -3'
(R):5'- GACTTAGGTAGTCGCTCACAAATAC -3'
Posted On 2014-11-11