Incidental Mutation 'R2374:Ly6e'
ID248242
Institutional Source Beutler Lab
Gene Symbol Ly6e
Ensembl Gene ENSMUSG00000022587
Gene Namelymphocyte antigen 6 complex, locus E
SynonymsRIG-E, TSA-1, Tsa1, Sca-2, Ly67, 9804
MMRRC Submission 040353-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2374 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74955051-74959905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74958621 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 107 (S107G)
Ref Sequence ENSEMBL: ENSMUSP00000139549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051698] [ENSMUST00000169343] [ENSMUST00000185861] [ENSMUST00000185863] [ENSMUST00000187284] [ENSMUST00000187606] [ENSMUST00000188042] [ENSMUST00000188866] [ENSMUST00000189186] [ENSMUST00000190810] [ENSMUST00000191127] [ENSMUST00000191436] [ENSMUST00000191145]
Predicted Effect probably damaging
Transcript: ENSMUST00000051698
AA Change: S107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056703
Gene: ENSMUSG00000022587
AA Change: S107G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169343
AA Change: S107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132081
Gene: ENSMUSG00000022587
AA Change: S107G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185861
AA Change: S107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141145
Gene: ENSMUSG00000022587
AA Change: S107G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185863
SMART Domains Protein: ENSMUSP00000140060
Gene: ENSMUSG00000022587

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
LU 43 111 5.7e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186927
Predicted Effect probably damaging
Transcript: ENSMUST00000187284
AA Change: S107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140553
Gene: ENSMUSG00000022587
AA Change: S107G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187606
AA Change: S107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139471
Gene: ENSMUSG00000022587
AA Change: S107G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188042
AA Change: S107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141059
Gene: ENSMUSG00000022587
AA Change: S107G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188503
Predicted Effect probably damaging
Transcript: ENSMUST00000188866
AA Change: S107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140145
Gene: ENSMUSG00000022587
AA Change: S107G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189186
SMART Domains Protein: ENSMUSP00000139477
Gene: ENSMUSG00000022587

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPAR_LY6 29 64 3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190810
AA Change: S107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139482
Gene: ENSMUSG00000022587
AA Change: S107G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 4.1e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191127
AA Change: S107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139966
Gene: ENSMUSG00000022587
AA Change: S107G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 4.1e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191436
AA Change: S107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139549
Gene: ENSMUSG00000022587
AA Change: S107G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.6e-28 SMART
low complexity region 119 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191439
Predicted Effect probably benign
Transcript: ENSMUST00000191145
SMART Domains Protein: ENSMUSP00000140829
Gene: ENSMUSG00000022587

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
LU 42 117 2.4e-15 SMART
Meta Mutation Damage Score 0.1643 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos as a result of heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,820,574 Y60H probably damaging Het
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Clec4b1 T G 6: 123,050,638 L18R probably damaging Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr1272 A T 2: 90,282,451 S41R possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tbc1d12 T A 19: 38,837,170 L155Q possibly damaging Het
Tnni3k A T 3: 154,786,785 M816K probably benign Het
Ugt2a3 T C 5: 87,327,191 D398G probably damaging Het
Vmn1r25 A T 6: 57,978,558 S249T probably benign Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zbtb26 A G 2: 37,436,485 S180P probably benign Het
Zfy1 G C Y: 726,392 L458V possibly damaging Het
Zfy1 A T Y: 726,391 L458Q probably damaging Het
Zmpste24 T C 4: 121,074,537 E297G probably benign Het
Other mutations in Ly6e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Ly6e APN 15 74958697 missense probably benign 0.38
R0926:Ly6e UTSW 15 74958370 missense probably damaging 0.99
R2083:Ly6e UTSW 15 74958319 missense probably damaging 1.00
R4328:Ly6e UTSW 15 74958521 missense probably damaging 0.97
R4512:Ly6e UTSW 15 74957833 missense probably damaging 1.00
R4646:Ly6e UTSW 15 74958661 splice site probably null
R7509:Ly6e UTSW 15 74958286 missense probably damaging 1.00
R7706:Ly6e UTSW 15 74958334 missense possibly damaging 0.90
R7892:Ly6e UTSW 15 74957851 nonsense probably null
R8431:Ly6e UTSW 15 74958341 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGAGTAGCTGCCTGTTTCC -3'
(R):5'- AGCTGAAGGTTCCTAGGGTC -3'

Sequencing Primer
(F):5'- GAGTAGCTGCCTGTTTCCCTAGC -3'
(R):5'- TCCCCTGGGACCTAAAAGGAG -3'
Posted On2014-11-11