Incidental Mutation 'R2374:Zfy1'
ID248248
Institutional Source Beutler Lab
Gene Symbol Zfy1
Ensembl Gene ENSMUSG00000053211
Gene Namezinc finger protein 1, Y-linked
SynonymsZfy-1
MMRRC Submission 040353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R2374 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location725128-797409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 726391 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 458 (L458Q)
Ref Sequence ENSEMBL: ENSMUSP00000140600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065545] [ENSMUST00000189888]
Predicted Effect probably damaging
Transcript: ENSMUST00000065545
AA Change: L458Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069364
Gene: ENSMUSG00000053211
AA Change: L458Q

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 68 388 1.1e-109 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189888
AA Change: L458Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140600
Gene: ENSMUSG00000053211
AA Change: L458Q

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 67 388 1.2e-141 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,820,574 Y60H probably damaging Het
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Clec4b1 T G 6: 123,050,638 L18R probably damaging Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Ly6e A G 15: 74,958,621 S107G probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr1272 A T 2: 90,282,451 S41R possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tbc1d12 T A 19: 38,837,170 L155Q possibly damaging Het
Tnni3k A T 3: 154,786,785 M816K probably benign Het
Ugt2a3 T C 5: 87,327,191 D398G probably damaging Het
Vmn1r25 A T 6: 57,978,558 S249T probably benign Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zbtb26 A G 2: 37,436,485 S180P probably benign Het
Zmpste24 T C 4: 121,074,537 E297G probably benign Het
Other mutations in Zfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0149:Zfy1 UTSW Y 726121 missense possibly damaging 0.95
R0361:Zfy1 UTSW Y 726121 missense possibly damaging 0.95
R0529:Zfy1 UTSW Y 726040 missense probably damaging 1.00
R0837:Zfy1 UTSW Y 725850 nonsense probably null
R0945:Zfy1 UTSW Y 725983 missense probably damaging 0.98
R1163:Zfy1 UTSW Y 725611 missense probably damaging 0.98
R1394:Zfy1 UTSW Y 725957 missense possibly damaging 0.79
R1806:Zfy1 UTSW Y 725620 missense possibly damaging 0.88
R1928:Zfy1 UTSW Y 729733 missense unknown
R2374:Zfy1 UTSW Y 726392 missense possibly damaging 0.77
R2889:Zfy1 UTSW Y 726307 missense possibly damaging 0.95
R2980:Zfy1 UTSW Y 739054 missense unknown
R3437:Zfy1 UTSW Y 726357 missense possibly damaging 0.82
R4454:Zfy1 UTSW Y 725518 missense possibly damaging 0.86
R4529:Zfy1 UTSW Y 726511 missense possibly damaging 0.93
R4656:Zfy1 UTSW Y 729626 missense unknown
R5049:Zfy1 UTSW Y 726004 missense possibly damaging 0.93
R5087:Zfy1 UTSW Y 732964 missense unknown
R5347:Zfy1 UTSW Y 725950 missense possibly damaging 0.90
R5428:Zfy1 UTSW Y 726205 missense possibly damaging 0.95
R5825:Zfy1 UTSW Y 726531 missense possibly damaging 0.85
R6256:Zfy1 UTSW Y 738765 missense unknown
R7065:Zfy1 UTSW Y 725428 missense probably benign 0.33
R7134:Zfy1 UTSW Y 725788 missense probably damaging 0.99
R7185:Zfy1 UTSW Y 725464 missense possibly damaging 0.53
R7358:Zfy1 UTSW Y 735141 missense unknown
R7513:Zfy1 UTSW Y 759852 missense unknown
R7747:Zfy1 UTSW Y 725496 nonsense probably null
R7900:Zfy1 UTSW Y 725519 missense possibly damaging 0.53
R8052:Zfy1 UTSW Y 726004 missense possibly damaging 0.93
R8377:Zfy1 UTSW Y 725723 missense possibly damaging 0.90
R8795:Zfy1 UTSW Y 738945 missense unknown
R8854:Zfy1 UTSW Y 726501 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAATTTCTTCCTGTGGACCACC -3'
(R):5'- ATTTGTTGCTCCTGATGGACAAAC -3'

Sequencing Primer
(F):5'- CCAAAAGGTGGTGATTCAATAATGTC -3'
(R):5'- GCTCCTGATGGACAAACTTTACGTG -3'
Posted On2014-11-11