Incidental Mutation 'R0302:Mfsd6'
ID24825
Institutional Source Beutler Lab
Gene Symbol Mfsd6
Ensembl Gene ENSMUSG00000041439
Gene Namemajor facilitator superfamily domain containing 6
SynonymsMMR2, 9630025I22Rik, 2210010L05Rik
MMRRC Submission 038514-MU
Accession Numbers

Ncbi RefSeq: NM_133829.2, NM_178081.4; MGI:1922925

Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location52656286-52727462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52709457 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 83 (Y83C)
Ref Sequence ENSEMBL: ENSMUSP00000122881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087701] [ENSMUST00000156876]
Predicted Effect probably damaging
Transcript: ENSMUST00000087701
AA Change: Y83C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084991
Gene: ENSMUSG00000041439
AA Change: Y83C

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:MFS_1_like 68 144 4.8e-19 PFAM
Pfam:MFS_1 70 162 7e-11 PFAM
Pfam:MFS_2 72 571 3.8e-13 PFAM
Pfam:Nuc_H_symport 424 628 1.1e-11 PFAM
Pfam:MFS_1 453 708 6.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147421
Predicted Effect probably benign
Transcript: ENSMUST00000147758
SMART Domains Protein: ENSMUSP00000115398
Gene: ENSMUSG00000041439

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
transmembrane domain 200 219 N/A INTRINSIC
Pfam:Nuc_H_symport 255 459 1.4e-11 PFAM
Pfam:MFS_1 284 539 6.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156876
AA Change: Y83C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122881
Gene: ENSMUSG00000041439
AA Change: Y83C

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:MFS_1_like 68 144 6.2e-20 PFAM
Pfam:MFS_1 70 162 1.8e-10 PFAM
low complexity region 258 270 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 369 388 N/A INTRINSIC
Pfam:Nuc_H_symport 424 628 2.6e-11 PFAM
Pfam:MFS_1 453 707 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190228
Meta Mutation Damage Score 0.5337 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Mfsd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Mfsd6 APN 1 52708254 missense probably damaging 1.00
IGL00820:Mfsd6 APN 1 52708306 missense probably damaging 1.00
IGL01518:Mfsd6 APN 1 52709322 missense probably damaging 1.00
IGL02111:Mfsd6 APN 1 52708344 missense probably damaging 1.00
IGL02517:Mfsd6 APN 1 52663277 splice site probably benign
IGL02687:Mfsd6 APN 1 52708675 missense probably damaging 0.99
IGL02887:Mfsd6 APN 1 52708878 missense probably benign 0.19
IGL02901:Mfsd6 APN 1 52708473 missense probably benign 0.07
IGL03030:Mfsd6 APN 1 52709703 start codon destroyed probably null 1.00
PIT4280001:Mfsd6 UTSW 1 52660880 missense probably benign 0.00
PIT4466001:Mfsd6 UTSW 1 52708897 missense probably benign 0.03
R0043:Mfsd6 UTSW 1 52708652 nonsense probably null
R0113:Mfsd6 UTSW 1 52709189 missense probably damaging 1.00
R0226:Mfsd6 UTSW 1 52658690 intron probably benign
R0613:Mfsd6 UTSW 1 52658696 intron probably benign
R1126:Mfsd6 UTSW 1 52709511 missense probably benign 0.16
R1368:Mfsd6 UTSW 1 52708605 missense possibly damaging 0.49
R1471:Mfsd6 UTSW 1 52709557 missense probably benign 0.32
R1733:Mfsd6 UTSW 1 52709365 missense probably damaging 1.00
R1768:Mfsd6 UTSW 1 52660805 critical splice donor site probably null
R1951:Mfsd6 UTSW 1 52709358 missense probably damaging 1.00
R2031:Mfsd6 UTSW 1 52708854 missense probably benign 0.04
R2116:Mfsd6 UTSW 1 52660975 missense probably benign 0.21
R2240:Mfsd6 UTSW 1 52660819 missense probably damaging 0.97
R2242:Mfsd6 UTSW 1 52709598 missense probably benign 0.03
R2303:Mfsd6 UTSW 1 52676513 missense probably damaging 0.98
R2382:Mfsd6 UTSW 1 52708410 missense probably benign 0.10
R4568:Mfsd6 UTSW 1 52663289 nonsense probably null
R4801:Mfsd6 UTSW 1 52709596 missense probably benign 0.08
R4802:Mfsd6 UTSW 1 52709596 missense probably benign 0.08
R4958:Mfsd6 UTSW 1 52661024 missense probably damaging 1.00
R5134:Mfsd6 UTSW 1 52708356 missense possibly damaging 0.80
R5827:Mfsd6 UTSW 1 52662392 missense probably damaging 1.00
R5844:Mfsd6 UTSW 1 52658383 missense probably benign
R6124:Mfsd6 UTSW 1 52708252 missense probably damaging 1.00
R6435:Mfsd6 UTSW 1 52709444 nonsense probably null
R6515:Mfsd6 UTSW 1 52660961 missense probably damaging 1.00
R6874:Mfsd6 UTSW 1 52660709 missense probably benign 0.02
R6878:Mfsd6 UTSW 1 52708753 missense probably damaging 0.98
R7111:Mfsd6 UTSW 1 52709758 splice site probably null
R7170:Mfsd6 UTSW 1 52662388 critical splice donor site probably null
R7242:Mfsd6 UTSW 1 52709474 missense probably damaging 0.98
R7548:Mfsd6 UTSW 1 52663287 missense possibly damaging 0.79
R7664:Mfsd6 UTSW 1 52709053 missense probably benign 0.00
R7686:Mfsd6 UTSW 1 52662395 missense probably benign 0.00
R7747:Mfsd6 UTSW 1 52676547 missense probably benign 0.05
R7763:Mfsd6 UTSW 1 52708640 missense probably benign
Z1177:Mfsd6 UTSW 1 52658501 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCTTTCTGAAACGATCTGCAAC -3'
(R):5'- TGACCCTAATGGTGGTGGTAAGCC -3'

Sequencing Primer
(F):5'- TTTCTGAAACGATCTGCAACTACAC -3'
(R):5'- GCTGCTGATGATAAAGTTGCTATCC -3'
Posted On2013-04-16