Incidental Mutation 'R2375:Gtf2ird2'
ID248256
Institutional Source Beutler Lab
Gene Symbol Gtf2ird2
Ensembl Gene ENSMUSG00000015942
Gene NameGTF2I repeat domain containing 2
Synonyms1700012P16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2375 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location134184019-134224355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134217135 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 745 (L745Q)
Ref Sequence ENSEMBL: ENSMUSP00000016086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016086] [ENSMUST00000016094] [ENSMUST00000111275] [ENSMUST00000123941] [ENSMUST00000144086] [ENSMUST00000146354] [ENSMUST00000152587]
Predicted Effect probably benign
Transcript: ENSMUST00000016086
AA Change: L745Q

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000016086
Gene: ENSMUSG00000015942
AA Change: L745Q

DomainStartEndE-ValueType
Pfam:GTF2I 104 178 6.1e-31 PFAM
Pfam:GTF2I 328 402 1.6e-25 PFAM
Blast:Tryp_SPc 436 491 4e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000016094
SMART Domains Protein: ENSMUSP00000016094
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 403 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111275
SMART Domains Protein: ENSMUSP00000106906
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128842
Predicted Effect probably benign
Transcript: ENSMUST00000135588
Predicted Effect probably benign
Transcript: ENSMUST00000144086
SMART Domains Protein: ENSMUSP00000138547
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
low complexity region 336 344 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146354
SMART Domains Protein: ENSMUSP00000138121
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182626
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Arhgef7 A G 8: 11,814,995 N369S probably benign Het
BC003331 A G 1: 150,390,234 probably null Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cps1 G A 1: 67,217,860 M1312I probably benign Het
Fbn2 A C 18: 58,035,966 I2247S probably damaging Het
Lrr1 A G 12: 69,174,923 T280A probably benign Het
Mpig6b C T 17: 35,064,383 M226I probably benign Het
Myo1a A G 10: 127,705,290 D12G probably damaging Het
Olfr802 A G 10: 129,682,163 F192S probably benign Het
Orc5 A G 5: 22,546,552 L71P probably damaging Het
Phc2 T C 4: 128,723,025 S364P probably benign Het
Ramp3 G T 11: 6,676,643 V117L probably benign Het
Rpap1 C A 2: 119,770,407 W836L possibly damaging Het
Syt13 G A 2: 92,946,151 G261D probably benign Het
Taf6 A T 5: 138,182,201 Y300* probably null Het
Thsd7a T C 6: 12,337,362 S1219G probably damaging Het
Tmco3 T C 8: 13,292,059 F111S possibly damaging Het
Upk1b C T 16: 38,787,128 G79E probably damaging Het
Zc3h7b G A 15: 81,792,502 V773M probably benign Het
Zfp655 A G 5: 145,244,396 T355A probably benign Het
Other mutations in Gtf2ird2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gtf2ird2 APN 5 134196553 missense possibly damaging 0.93
IGL01295:Gtf2ird2 APN 5 134192764 missense probably damaging 1.00
IGL01603:Gtf2ird2 APN 5 134202288 splice site probably benign
IGL01824:Gtf2ird2 APN 5 134197282 splice site probably benign
IGL02469:Gtf2ird2 APN 5 134191249 missense probably damaging 1.00
IGL02525:Gtf2ird2 APN 5 134216477 missense probably benign 0.03
IGL02567:Gtf2ird2 APN 5 134213048 unclassified probably benign
IGL02750:Gtf2ird2 APN 5 134216889 missense probably damaging 0.99
IGL02992:Gtf2ird2 APN 5 134217614 missense possibly damaging 0.79
IGL03000:Gtf2ird2 APN 5 134194906 missense probably benign 0.45
IGL03114:Gtf2ird2 APN 5 134216910 unclassified probably null
IGL03180:Gtf2ird2 APN 5 134191248 missense probably damaging 1.00
R0077:Gtf2ird2 UTSW 5 134214083 missense probably damaging 1.00
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0344:Gtf2ird2 UTSW 5 134191249 missense probably damaging 1.00
R0568:Gtf2ird2 UTSW 5 134211242 nonsense probably null
R0570:Gtf2ird2 UTSW 5 134208944 critical splice donor site probably null
R0730:Gtf2ird2 UTSW 5 134192758 nonsense probably null
R0826:Gtf2ird2 UTSW 5 134216955 missense probably damaging 1.00
R1707:Gtf2ird2 UTSW 5 134216987 missense probably damaging 1.00
R1710:Gtf2ird2 UTSW 5 134211240 missense probably benign 0.26
R2064:Gtf2ird2 UTSW 5 134216498 nonsense probably null
R2284:Gtf2ird2 UTSW 5 134217183 missense probably benign 0.05
R3104:Gtf2ird2 UTSW 5 134208915 missense probably benign 0.42
R4436:Gtf2ird2 UTSW 5 134194969 missense possibly damaging 0.95
R4647:Gtf2ird2 UTSW 5 134216192 missense probably damaging 1.00
R4708:Gtf2ird2 UTSW 5 134216298 missense probably damaging 0.99
R4775:Gtf2ird2 UTSW 5 134214128 missense probably benign 0.01
R4999:Gtf2ird2 UTSW 5 134217464 missense probably damaging 0.97
R5011:Gtf2ird2 UTSW 5 134216982 missense possibly damaging 0.90
R5036:Gtf2ird2 UTSW 5 134217507 missense probably damaging 1.00
R5261:Gtf2ird2 UTSW 5 134216219 missense probably benign 0.00
R5379:Gtf2ird2 UTSW 5 134217468 missense probably benign
R5921:Gtf2ird2 UTSW 5 134217584 missense probably damaging 1.00
R6180:Gtf2ird2 UTSW 5 134216547 missense probably damaging 1.00
R6483:Gtf2ird2 UTSW 5 134211225 missense probably benign 0.00
R7355:Gtf2ird2 UTSW 5 134216649 missense probably benign 0.24
R7475:Gtf2ird2 UTSW 5 134201426 missense possibly damaging 0.47
R7566:Gtf2ird2 UTSW 5 134214006 missense probably damaging 1.00
R8021:Gtf2ird2 UTSW 5 134203334 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCTCAAATCCGTGCGC -3'
(R):5'- CTCGCTCTCACACGACTTGAAA -3'

Sequencing Primer
(F):5'- GCGCTGTATCATTCACCCAGAG -3'
(R):5'- CAGCTCCACGATCTTAGGGATGTAG -3'
Posted On2014-11-11