Incidental Mutation 'R2375:Upk1b'
ID248271
Institutional Source Beutler Lab
Gene Symbol Upk1b
Ensembl Gene ENSMUSG00000049436
Gene Nameuroplakin 1B
SynonymsTspan20, Upk1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2375 (G1)
Quality Score165
Status Not validated
Chromosome16
Chromosomal Location38773184-38800328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38787128 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 79 (G79E)
Ref Sequence ENSEMBL: ENSMUSP00000052469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057767]
Predicted Effect probably damaging
Transcript: ENSMUST00000057767
AA Change: G79E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052469
Gene: ENSMUSG00000049436
AA Change: G79E

DomainStartEndE-ValueType
Pfam:Tetraspannin 10 258 6.9e-29 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is found in the asymmetrical unit membrane (AUM) where it can form a complex with other transmembrane 4 superfamily proteins. It may play a role in normal bladder epithelial physiology, possibly in regulating membrane permeability of superficial umbrella cells or in stabilizing the apical membrane through AUM/cytoskeletal interactions. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a reporter allele are viable, fertile, and physically and behaviorally normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Arhgef7 A G 8: 11,814,995 N369S probably benign Het
BC003331 A G 1: 150,390,234 probably null Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cps1 G A 1: 67,217,860 M1312I probably benign Het
Fbn2 A C 18: 58,035,966 I2247S probably damaging Het
Gtf2ird2 T A 5: 134,217,135 L745Q probably benign Het
Lrr1 A G 12: 69,174,923 T280A probably benign Het
Mpig6b C T 17: 35,064,383 M226I probably benign Het
Myo1a A G 10: 127,705,290 D12G probably damaging Het
Olfr802 A G 10: 129,682,163 F192S probably benign Het
Orc5 A G 5: 22,546,552 L71P probably damaging Het
Phc2 T C 4: 128,723,025 S364P probably benign Het
Ramp3 G T 11: 6,676,643 V117L probably benign Het
Rpap1 C A 2: 119,770,407 W836L possibly damaging Het
Syt13 G A 2: 92,946,151 G261D probably benign Het
Taf6 A T 5: 138,182,201 Y300* probably null Het
Thsd7a T C 6: 12,337,362 S1219G probably damaging Het
Tmco3 T C 8: 13,292,059 F111S possibly damaging Het
Zc3h7b G A 15: 81,792,502 V773M probably benign Het
Zfp655 A G 5: 145,244,396 T355A probably benign Het
Other mutations in Upk1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Upk1b APN 16 38780016 missense possibly damaging 0.93
IGL00953:Upk1b APN 16 38779985 missense possibly damaging 0.95
IGL02879:Upk1b APN 16 38776278 splice site probably benign
IGL03067:Upk1b APN 16 38784910 missense probably damaging 1.00
R0969:Upk1b UTSW 16 38787299 splice site probably benign
R1755:Upk1b UTSW 16 38780040 missense probably benign 0.04
R1916:Upk1b UTSW 16 38776186 critical splice donor site probably null
R1989:Upk1b UTSW 16 38784241 missense possibly damaging 0.94
R2101:Upk1b UTSW 16 38780137 nonsense probably null
R4564:Upk1b UTSW 16 38780107 missense probably benign 0.00
R4796:Upk1b UTSW 16 38787242 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGGCCCAGGAAAACAACTG -3'
(R):5'- AAGCCTGACAGACTCATTCTC -3'

Sequencing Primer
(F):5'- GCTACGTAGCCAAGGATTACCTG -3'
(R):5'- AGCCTGACAGACTCATTCTCATCTTG -3'
Posted On2014-11-11