Incidental Mutation 'R2376:Vmn1r88'
ID248279
Institutional Source Beutler Lab
Gene Symbol Vmn1r88
Ensembl Gene ENSMUSG00000095902
Gene Namevomeronasal 1 receptor, 88
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2376 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13177719-13178669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13177858 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 47 (V47D)
Ref Sequence ENSEMBL: ENSMUSP00000128946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171783]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122190
Predicted Effect probably damaging
Transcript: ENSMUST00000171783
AA Change: V47D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128946
Gene: ENSMUSG00000095902
AA Change: V47D

DomainStartEndE-ValueType
Pfam:TAS2R 1 306 2e-14 PFAM
Pfam:V1R 35 301 1.4e-30 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,912,831 V254E probably benign Het
Anapc16 T C 10: 59,988,757 E119G possibly damaging Het
Ankrd13d T A 19: 4,272,595 I350F possibly damaging Het
Asb6 A G 2: 30,824,402 M232T probably benign Het
BC030867 A G 11: 102,250,716 D14G probably benign Het
Cacna1g A G 11: 94,465,908 V134A probably damaging Het
Catsperz A T 19: 6,924,898 L76H probably damaging Het
Eno4 T C 19: 58,953,226 V17A probably benign Het
Ltn1 A G 16: 87,420,807 probably null Het
Myh9 G T 15: 77,783,417 D605E probably benign Het
Obscn C T 11: 59,069,124 A3515T probably damaging Het
Pck1 A G 2: 173,157,116 K389R probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Plce1 G A 19: 38,777,986 V2138I probably benign Het
Pou4f2 T G 8: 78,436,185 S74R unknown Het
Ptpn21 A T 12: 98,688,314 M798K possibly damaging Het
Rhag G T 17: 40,811,363 probably null Het
Utp6 C G 11: 79,955,613 E181Q probably damaging Het
Vcan G T 13: 89,703,410 Q1144K possibly damaging Het
Other mutations in Vmn1r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01828:Vmn1r88 APN 7 13177735 missense probably damaging 1.00
IGL01879:Vmn1r88 APN 7 13178302 missense probably benign 0.12
IGL02028:Vmn1r88 APN 7 13177792 missense probably benign
IGL02586:Vmn1r88 APN 7 13177808 nonsense probably null
IGL03176:Vmn1r88 APN 7 13177852 missense probably damaging 1.00
PIT4466001:Vmn1r88 UTSW 7 13178476 missense possibly damaging 0.83
R1163:Vmn1r88 UTSW 7 13178133 missense probably benign
R1478:Vmn1r88 UTSW 7 13177951 missense probably damaging 1.00
R3624:Vmn1r88 UTSW 7 13177863 missense probably benign 0.08
R4543:Vmn1r88 UTSW 7 13177980 missense possibly damaging 0.52
R4593:Vmn1r88 UTSW 7 13177842 missense probably damaging 0.96
R4721:Vmn1r88 UTSW 7 13178524 nonsense probably null
R5927:Vmn1r88 UTSW 7 13178513 missense probably benign 0.12
R6411:Vmn1r88 UTSW 7 13178043 missense probably damaging 1.00
R6535:Vmn1r88 UTSW 7 13178185 missense probably benign 0.03
R6598:Vmn1r88 UTSW 7 13178223 missense probably damaging 1.00
R6857:Vmn1r88 UTSW 7 13178331 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCTCCTGAGATGTCAATCAG -3'
(R):5'- TGCTTAGAACAGAGGTGGTG -3'

Sequencing Primer
(F):5'- AGTCCATTCATTTAGTACTCTAGACC -3'
(R):5'- TGGTGCAGATGGACAGACCC -3'
Posted On2014-11-11