Mutagenetix > Incidental Mutation

Incidental Mutation 'R2376:Ltn1'

248291

Institutional Source

Beutler Lab

Gene Symbol

Ltn1

Ensembl Gene

ENSMUSG00000052299

Gene Name

listerin E3 ubiquitin protein ligase 1

Synonyms

4930528H02Rik, Rnf160, Zfp294, Listerin

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2376 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87376651-87432612 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 87420807 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000156299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000039449] [ENSMUST00000232095] [ENSMUST00000232095]

AlphaFold

Q6A009

Predicted Effect

probably null
Transcript: ENSMUST00000039449

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000039449

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083713

Predicted Effect

probably null
Transcript: ENSMUST00000232095

Predicted Effect

probably null
Transcript: ENSMUST00000232095

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts9	A	T	6: 92,912,831	V254E	probably benign	Het
Anapc16	T	C	10: 59,988,757	E119G	possibly damaging	Het
Ankrd13d	T	A	19: 4,272,595	I350F	possibly damaging	Het
Asb6	A	G	2: 30,824,402	M232T	probably benign	Het
BC030867	A	G	11: 102,250,716	D14G	probably benign	Het
Cacna1g	A	G	11: 94,465,908	V134A	probably damaging	Het
Catsperz	A	T	19: 6,924,898	L76H	probably damaging	Het
Eno4	T	C	19: 58,953,226	V17A	probably benign	Het
Myh9	G	T	15: 77,783,417	D605E	probably benign	Het
Obscn	C	T	11: 59,069,124	A3515T	probably damaging	Het
Pck1	A	G	2: 173,157,116	K389R	probably benign	Het
Pde10a	A	G	17: 8,930,537	Y407C	probably damaging	Het
Plce1	G	A	19: 38,777,986	V2138I	probably benign	Het
Pou4f2	T	G	8: 78,436,185	S74R	unknown	Het
Ptpn21	A	T	12: 98,688,314	M798K	possibly damaging	Het
Rhag	G	T	17: 40,811,363		probably null	Het
Utp6	C	G	11: 79,955,613	E181Q	probably damaging	Het
Vcan	G	T	13: 89,703,410	Q1144K	possibly damaging	Het
Vmn1r88	T	A	7: 13,177,858	V47D	probably damaging	Het

Other mutations in Ltn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Ltn1	APN	16	87418490	missense	probably benign	0.03
IGL01139:Ltn1	APN	16	87416009	missense	probably benign	0.04
IGL01359:Ltn1	APN	16	87405693	splice site	probably benign
IGL01503:Ltn1	APN	16	87420807	critical splice donor site	probably benign
IGL01529:Ltn1	APN	16	87381471	missense	probably benign	0.00
IGL02437:Ltn1	APN	16	87398001	missense	probably benign	0.04
IGL02658:Ltn1	APN	16	87415774	missense	probably damaging	1.00
IGL02890:Ltn1	APN	16	87409297	splice site	probably null
IGL02899:Ltn1	APN	16	87382659	missense	probably benign	0.34
IGL02902:Ltn1	APN	16	87379805	missense	possibly damaging	0.70
IGL03128:Ltn1	APN	16	87415944	missense	probably benign	0.00
IGL03392:Ltn1	APN	16	87425611	missense	probably damaging	1.00
IGL03046:Ltn1	UTSW	16	87405621	missense	probably benign	0.10
PIT4305001:Ltn1	UTSW	16	87420323	missense	probably damaging	1.00
PIT4366001:Ltn1	UTSW	16	87380840	nonsense	probably null
R0126:Ltn1	UTSW	16	87425640	missense	probably benign	0.00
R0164:Ltn1	UTSW	16	87405519	splice site	probably benign
R0165:Ltn1	UTSW	16	87405519	splice site	probably benign
R0280:Ltn1	UTSW	16	87397838	missense	probably damaging	1.00
R0565:Ltn1	UTSW	16	87416010	missense	probably benign	0.01
R0733:Ltn1	UTSW	16	87412507	missense	probably benign	0.01
R1034:Ltn1	UTSW	16	87397137	splice site	probably null
R1252:Ltn1	UTSW	16	87416030	missense	probably benign	0.00
R1524:Ltn1	UTSW	16	87381556	missense	probably damaging	1.00
R1746:Ltn1	UTSW	16	87411781	missense	possibly damaging	0.86
R1826:Ltn1	UTSW	16	87415616	missense	probably damaging	1.00
R1831:Ltn1	UTSW	16	87400146	missense	possibly damaging	0.94
R1839:Ltn1	UTSW	16	87416264	nonsense	probably null
R1860:Ltn1	UTSW	16	87416343	missense	probably benign	0.06
R1997:Ltn1	UTSW	16	87381637	missense	probably damaging	1.00
R2109:Ltn1	UTSW	16	87415642	missense	probably benign	0.03
R2134:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2135:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2193:Ltn1	UTSW	16	87427647	missense	probably damaging	1.00
R2307:Ltn1	UTSW	16	87432424	critical splice donor site	probably null
R3054:Ltn1	UTSW	16	87404073	missense	probably benign	0.32
R3404:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3405:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3618:Ltn1	UTSW	16	87420899	missense	probably damaging	1.00
R4065:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4066:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4067:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4288:Ltn1	UTSW	16	87397988	missense	possibly damaging	0.57
R4436:Ltn1	UTSW	16	87405614	missense	probably benign	0.17
R4535:Ltn1	UTSW	16	87426286	missense	probably damaging	1.00
R4581:Ltn1	UTSW	16	87402024	critical splice donor site	probably null
R4669:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R4715:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R4830:Ltn1	UTSW	16	87379694	missense	probably damaging	1.00
R4887:Ltn1	UTSW	16	87398809	nonsense	probably null
R4961:Ltn1	UTSW	16	87397791	missense	probably benign
R4992:Ltn1	UTSW	16	87405587	missense	possibly damaging	0.70
R5073:Ltn1	UTSW	16	87427740	missense	probably damaging	0.99
R5288:Ltn1	UTSW	16	87416011	missense	possibly damaging	0.80
R5802:Ltn1	UTSW	16	87415681	missense	probably benign	0.17
R5907:Ltn1	UTSW	16	87381503	missense	possibly damaging	0.94
R6180:Ltn1	UTSW	16	87427789	missense	probably damaging	1.00
R6194:Ltn1	UTSW	16	87415810	missense	probably damaging	1.00
R6257:Ltn1	UTSW	16	87411774	missense	possibly damaging	0.74
R6301:Ltn1	UTSW	16	87420306	missense	probably benign
R6481:Ltn1	UTSW	16	87378980	missense	probably damaging	1.00
R6525:Ltn1	UTSW	16	87420186	missense	probably damaging	1.00
R6958:Ltn1	UTSW	16	87397791	missense	probably benign
R6969:Ltn1	UTSW	16	87415690	missense	probably damaging	1.00
R7002:Ltn1	UTSW	16	87423473	missense	probably benign
R7038:Ltn1	UTSW	16	87424871	missense	probably damaging	1.00
R7062:Ltn1	UTSW	16	87427603	missense	probably damaging	0.98
R7152:Ltn1	UTSW	16	87427641	missense	probably damaging	1.00
R7180:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R7247:Ltn1	UTSW	16	87409387	missense	probably benign	0.00
R7454:Ltn1	UTSW	16	87397812	missense	probably benign	0.03
R7471:Ltn1	UTSW	16	87397899	missense	probably benign
R7511:Ltn1	UTSW	16	87408828	missense	possibly damaging	0.63
R7691:Ltn1	UTSW	16	87398686	missense	probably damaging	0.99
R7702:Ltn1	UTSW	16	87426278	missense	probably damaging	1.00
R7761:Ltn1	UTSW	16	87411793	missense	probably benign
R8002:Ltn1	UTSW	16	87415947	missense	probably benign	0.17
R8101:Ltn1	UTSW	16	87418497	missense	probably damaging	1.00
R8142:Ltn1	UTSW	16	87381641	missense	probably benign	0.21
R8214:Ltn1	UTSW	16	87380803	missense	probably benign	0.02
R8674:Ltn1	UTSW	16	87398785	missense	probably benign
R8783:Ltn1	UTSW	16	87410359	missense	probably benign	0.30
R8839:Ltn1	UTSW	16	87418502	missense	probably damaging	1.00
R8885:Ltn1	UTSW	16	87381545	missense	probably damaging	1.00
R8889:Ltn1	UTSW	16	87432342	intron	probably benign
R8892:Ltn1	UTSW	16	87432342	intron	probably benign
R8919:Ltn1	UTSW	16	87381493	missense	probably damaging	0.98
R8970:Ltn1	UTSW	16	87416038	missense	probably benign
R9113:Ltn1	UTSW	16	87427644	missense	probably damaging	1.00
R9206:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9208:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9234:Ltn1	UTSW	16	87397201	missense	probably damaging	0.98
R9421:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R9558:Ltn1	UTSW	16	87423407	missense	probably benign	0.05
R9654:Ltn1	UTSW	16	87410339	missense	probably benign	0.00
R9738:Ltn1	UTSW	16	87425636	missense	probably damaging	1.00
X0028:Ltn1	UTSW	16	87402134	missense	probably benign	0.01
Z1177:Ltn1	UTSW	16	87402037	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCATTTACATGAAACCAACAGTC -3'
(R):5'- GGTCCGCTCAGCATATTTTGAG -3'

Sequencing Primer
(F):5'- GGTGGCTCACAACCATCTGTAATG -3'
(R):5'- CGCTCAGCATATTTTGAGTTAGTTTC -3'

Posted On

2014-11-11