Incidental Mutation 'R2376:Rhag'
ID248293
Institutional Source Beutler Lab
Gene Symbol Rhag
Ensembl Gene ENSMUSG00000023926
Gene NameRhesus blood group-associated A glycoprotein
SynonymsRh50, CD241, Rh50A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R2376 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location40811126-40840754 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 40811363 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024721] [ENSMUST00000024721]
Predicted Effect probably null
Transcript: ENSMUST00000024721
SMART Domains Protein: ENSMUSP00000024721
Gene: ENSMUSG00000023926

DomainStartEndE-ValueType
Pfam:Ammonium_transp 43 412 1.5e-83 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000024721
SMART Domains Protein: ENSMUSP00000024721
Gene: ENSMUSG00000023926

DomainStartEndE-ValueType
Pfam:Ammonium_transp 43 412 1.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124399
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is erythrocyte-specific and is thought to be part of a membrane channel that transports ammonium and carbon dioxide across the blood cell membrane. The encoded protein appears to interact with Rh blood group antigens and Rh30 polypeptides. Defects in this gene are a cause of regulator type Rh-null hemolytic anemia (RHN), or Rh-deficiency syndrome.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ammonium and methylammonium transport in red cell ghosts, reduced basal adhesion of red blood cells to endothelial cells, a slight increase in iron levels, and decreased transferrin levels in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,912,831 V254E probably benign Het
Anapc16 T C 10: 59,988,757 E119G possibly damaging Het
Ankrd13d T A 19: 4,272,595 I350F possibly damaging Het
Asb6 A G 2: 30,824,402 M232T probably benign Het
BC030867 A G 11: 102,250,716 D14G probably benign Het
Cacna1g A G 11: 94,465,908 V134A probably damaging Het
Catsperz A T 19: 6,924,898 L76H probably damaging Het
Eno4 T C 19: 58,953,226 V17A probably benign Het
Ltn1 A G 16: 87,420,807 probably null Het
Myh9 G T 15: 77,783,417 D605E probably benign Het
Obscn C T 11: 59,069,124 A3515T probably damaging Het
Pck1 A G 2: 173,157,116 K389R probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Plce1 G A 19: 38,777,986 V2138I probably benign Het
Pou4f2 T G 8: 78,436,185 S74R unknown Het
Ptpn21 A T 12: 98,688,314 M798K possibly damaging Het
Utp6 C G 11: 79,955,613 E181Q probably damaging Het
Vcan G T 13: 89,703,410 Q1144K possibly damaging Het
Vmn1r88 T A 7: 13,177,858 V47D probably damaging Het
Other mutations in Rhag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Rhag APN 17 40811287 missense possibly damaging 0.73
IGL01463:Rhag APN 17 40828755 missense probably damaging 1.00
IGL01954:Rhag APN 17 40828450 missense possibly damaging 0.88
IGL03000:Rhag APN 17 40828522 missense probably benign 0.00
R0385:Rhag UTSW 17 40834727 missense probably damaging 0.97
R0570:Rhag UTSW 17 40828913 splice site probably benign
R0811:Rhag UTSW 17 40831578 missense possibly damaging 0.74
R0812:Rhag UTSW 17 40831578 missense possibly damaging 0.74
R1655:Rhag UTSW 17 40831596 missense probably damaging 0.98
R2698:Rhag UTSW 17 40836476 missense probably damaging 0.99
R4207:Rhag UTSW 17 40831653 missense probably damaging 0.99
R4695:Rhag UTSW 17 40836467 missense probably damaging 0.99
R4705:Rhag UTSW 17 40836438 missense probably benign 0.35
R4729:Rhag UTSW 17 40828401 missense probably damaging 1.00
R4790:Rhag UTSW 17 40831290 missense probably benign 0.23
R4895:Rhag UTSW 17 40811351 missense probably benign
R5224:Rhag UTSW 17 40828504 missense probably damaging 0.98
R5685:Rhag UTSW 17 40831331 missense possibly damaging 0.88
R7403:Rhag UTSW 17 40834658 missense probably damaging 1.00
R7407:Rhag UTSW 17 40831334 missense possibly damaging 0.56
R7553:Rhag UTSW 17 40828395 missense probably damaging 1.00
R7884:Rhag UTSW 17 40831645 missense probably benign 0.06
R8056:Rhag UTSW 17 40828788 missense probably damaging 1.00
X0064:Rhag UTSW 17 40833505 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCTCTGCTGCAGTCATGAG -3'
(R):5'- CTTTATTTGAGGATGGTGACCAAC -3'

Sequencing Primer
(F):5'- GCTGCAGTCATGAGGTTCAAATTCC -3'
(R):5'- GTGACCAACACCTTTATTTCTTACAG -3'
Posted On2014-11-11