Mutagenetix > Incidental Mutations

Incidental Mutation 'R0302:Ass1'

24830

Institutional Source

Beutler Lab

Gene Symbol

Ass1

Ensembl Gene

ENSMUSG00000076441

Gene Name

argininosuccinate synthetase 1

Synonyms

Ass-1, ASS, fold

MMRRC Submission

038514-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0302 (G1)

Quality Score

216

Status

Validated

Chromosome

Chromosomal Location

31470207-31520672 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31514819 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 371 (N371Y)

Ref Sequence

ENSEMBL: ENSMUSP00000099904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102840]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102840
AA Change: N371Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: N371Y

Domain	Start	End	E-Value	Type
Pfam:QueC	6	93	2.8e-7	PFAM
Pfam:Arginosuc_synth	8	403	1.9e-177	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192802

Meta Mutation Damage Score

0.9349

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 95.1%
20x: 89.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprhl2	T	C	4: 126,317,392	E244G	probably benign	Het
Aldh1l2	G	A	10: 83,520,365	P54S	probably damaging	Het
Ankdd1a	G	A	9: 65,509,642		probably benign	Het
Ankra2	T	A	13: 98,271,692	S216R	probably damaging	Het
Asah2	A	T	19: 32,052,956	N105K	probably benign	Het
Cacna1s	A	G	1: 136,100,604	Y893C	probably benign	Het
Capza2	G	A	6: 17,648,524	R15H	probably benign	Het
Cbfa2t2	T	C	2: 154,534,876		probably benign	Het
Ccdc96	A	T	5: 36,486,101	T484S	possibly damaging	Het
Cckar	GCTTAGCCTCTTCT	GCT	5: 53,700,299		probably null	Het
Ccl4	T	A	11: 83,663,454		probably benign	Het
Cpt1b	A	G	15: 89,417,870	Y702H	probably benign	Het
Cr1l	G	A	1: 195,117,793	T153I	probably damaging	Het
Cyth2	C	A	7: 45,810,585	E57*	probably null	Het
Daxx	T	A	17: 33,913,620	S575T	probably damaging	Het
Depdc5	T	C	5: 32,904,546		probably benign	Het
Dnah12	A	G	14: 26,799,999	D1923G	probably damaging	Het
Dnah7b	A	G	1: 46,123,777	T428A	probably benign	Het
Dnm2	G	T	9: 21,500,343	A619S	probably benign	Het
Enpp2	T	C	15: 54,860,061	T639A	probably benign	Het
Epsti1	A	T	14: 77,939,926	H182L	probably damaging	Het
Exoc3l	C	T	8: 105,293,543	R250Q	probably benign	Het
Ggn	G	T	7: 29,171,240		probably null	Het
Il1rap	A	G	16: 26,692,794	N196S	probably benign	Het
Ints6	T	C	14: 62,709,512	T335A	probably damaging	Het
Itga1	G	A	13: 115,012,318		probably benign	Het
Kifc3	G	T	8: 95,103,470	Q557K	possibly damaging	Het
Krt23	A	G	11: 99,478,201	I422T	probably benign	Het
Lcn2	A	G	2: 32,384,889		probably benign	Het
Lonp2	A	G	8: 86,637,991	T326A	possibly damaging	Het
Lrpprc	T	C	17: 84,740,078	I909V	possibly damaging	Het
Lrrc14	G	T	15: 76,714,352	R396L	probably benign	Het
Lypd6	T	G	2: 50,165,667		probably benign	Het
Man2b1	A	G	8: 85,093,016	N610S	probably damaging	Het
Map2	A	T	1: 66,414,828	N959I	probably benign	Het
Mctp2	C	T	7: 72,090,264	V793I	possibly damaging	Het
Med25	A	C	7: 44,880,558		probably benign	Het
Mfsd6	T	C	1: 52,709,457	Y83C	probably damaging	Het
Mtbp	A	T	15: 55,625,424	M499L	probably damaging	Het
Mtmr10	A	T	7: 64,297,497	K53N	probably damaging	Het
Nfat5	T	C	8: 107,358,701	I542T	probably damaging	Het
Nr1h3	A	G	2: 91,192,013	M90T	probably damaging	Het
Nsmce4a	A	G	7: 130,545,893		probably benign	Het
Olfr1168	T	A	2: 88,185,510	I211N	possibly damaging	Het
Oprl1	G	A	2: 181,719,228	C318Y	probably benign	Het
Pbx3	A	T	2: 34,224,560	S46T	probably benign	Het
Pign	A	T	1: 105,589,093	F575I	possibly damaging	Het
Ptpn13	G	T	5: 103,565,225	S1738I	probably benign	Het
Rnf126	G	T	10: 79,759,223	P269Q	probably damaging	Het
Ryr3	G	A	2: 112,647,123		probably benign	Het
Slc2a7	C	T	4: 150,149,521	A31V	probably damaging	Het
Slc6a12	A	G	6: 121,363,259	D487G	probably damaging	Het
Son	G	T	16: 91,656,144	G593V	probably damaging	Het
Spata31d1a	T	C	13: 59,703,150	N388S	probably benign	Het
Spg11	A	T	2: 122,092,187	M927K	possibly damaging	Het
Taf13	A	G	3: 108,571,722	M1V	probably null	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Trio	A	G	15: 27,902,517	F286S	probably damaging	Het
Trpm2	A	C	10: 77,943,990		probably benign	Het
Ttc7b	T	C	12: 100,387,179	M390V	possibly damaging	Het
Vmn1r184	A	T	7: 26,267,543	Q238L	probably damaging	Het
Zfp236	T	C	18: 82,658,088	E368G	probably damaging	Het
Zfr2	G	T	10: 81,251,336		probably benign	Het

Other mutations in Ass1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Ass1	APN	2	31476922	missense	probably damaging	1.00
IGL02152:Ass1	APN	2	31492324	missense	probably damaging	1.00
R0008:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0083:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0084:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0085:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0087:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0183:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0220:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0254:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0346:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0440:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0472:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0605:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0644:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R1460:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1770:Ass1	UTSW	2	31486516	missense	probably benign	0.29
R1908:Ass1	UTSW	2	31493148	nonsense	probably null
R2361:Ass1	UTSW	2	31520382	missense	probably benign	0.02
R2430:Ass1	UTSW	2	31501496	missense	probably damaging	1.00
R3816:Ass1	UTSW	2	31510105	splice site	probably benign
R4614:Ass1	UTSW	2	31514783	missense	probably damaging	1.00
R4628:Ass1	UTSW	2	31480988	missense	probably damaging	1.00
R5007:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90
R5069:Ass1	UTSW	2	31510173	missense	probably damaging	1.00
R5081:Ass1	UTSW	2	31488653	critical splice donor site	probably null
R5315:Ass1	UTSW	2	31492329	missense	probably benign	0.21
R5370:Ass1	UTSW	2	31518733	missense	possibly damaging	0.56
R6259:Ass1	UTSW	2	31488642	missense	possibly damaging	0.80
R6541:Ass1	UTSW	2	31510233	missense	probably damaging	0.99
R6731:Ass1	UTSW	2	31514784	missense	probably damaging	1.00
R6927:Ass1	UTSW	2	31514801	missense	probably damaging	1.00
R7811:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R7995:Ass1	UTSW	2	31486540	missense	probably benign	0.00
R8504:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGTAAGGCAGAACCGAGCCTATCAG -3'
(R):5'- GCGCCACAGCCTAACTTTTATACCC -3'

Sequencing Primer
(F):5'- CCGAGCCTATCAGAAGGTAAG -3'
(R):5'- attactttgcatcagaaaatgacac -3'

Posted On

2013-04-16