Incidental Mutation 'R2377:Miga2'
ID248301
Institutional Source Beutler Lab
Gene Symbol Miga2
Ensembl Gene ENSMUSG00000026858
Gene Namemitoguardin 2
SynonymsFam73b, R74766, 5730472N09Rik
MMRRC Submission 040354-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2377 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30364233-30385521 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 30383990 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 83 (C83*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077977] [ENSMUST00000100214] [ENSMUST00000140075] [ENSMUST00000175864]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077977
AA Change: V546E

PolyPhen 2 Score 0.661 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077127
Gene: ENSMUSG00000026858
AA Change: V546E

DomainStartEndE-ValueType
Pfam:DUF2217 30 568 5.6e-242 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100214
AA Change: V546E

PolyPhen 2 Score 0.661 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097787
Gene: ENSMUSG00000026858
AA Change: V546E

DomainStartEndE-ValueType
Pfam:DUF2217 31 568 6.9e-228 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125610
Predicted Effect probably benign
Transcript: ENSMUST00000140075
SMART Domains Protein: ENSMUSP00000135519
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 30 393 5.1e-125 PFAM
low complexity region 409 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175864
AA Change: V92E

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135812
Gene: ENSMUSG00000026858
AA Change: V92E

DomainStartEndE-ValueType
Pfam:DUF2217 1 73 1.5e-46 PFAM
Pfam:DUF2217 70 114 7.7e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176517
AA Change: C83*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,467,923 D1304G probably damaging Het
Adamts10 C A 17: 33,528,892 H101N probably damaging Het
Apaf1 T A 10: 91,079,893 K44N possibly damaging Het
Aqr A T 2: 114,140,940 N471K possibly damaging Het
Blvrb T A 7: 27,459,599 I94N probably damaging Het
Ccdc38 C T 10: 93,574,035 P239S probably damaging Het
Chst4 T A 8: 110,030,172 Y270F possibly damaging Het
Col5a1 T C 2: 27,928,177 F138S unknown Het
Dhx32 G T 7: 133,724,478 H407N probably damaging Het
Dock3 G A 9: 106,895,891 P388S probably damaging Het
Fbxo10 A C 4: 45,044,719 Y639D probably benign Het
Fsip2 A G 2: 82,976,249 T971A probably benign Het
Gli2 C T 1: 118,837,125 A1099T possibly damaging Het
Hr C T 14: 70,557,878 L317F probably damaging Het
Ice1 G A 13: 70,602,780 A1729V probably damaging Het
Mcc C G 18: 44,519,549 K269N probably damaging Het
Msl1 A G 11: 98,803,963 R273G probably damaging Het
Msl3l2 T C 10: 56,115,563 I128T probably damaging Het
Ntrk1 T A 3: 87,791,407 D109V possibly damaging Het
Olfr126 A G 17: 37,850,607 N5S probably damaging Het
Olfr1307 A T 2: 111,944,643 L271Q probably damaging Het
Olfr142 A G 2: 90,252,911 F26L probably damaging Het
Olfr1447 T A 19: 12,900,853 Y309F possibly damaging Het
Pcmtd2 A G 2: 181,855,279 probably benign Het
Polr1a T C 6: 71,972,826 probably null Het
Ptk2b T A 14: 66,172,548 I452F possibly damaging Het
Rad21 A G 15: 51,968,438 F416L probably damaging Het
Scn5a A T 9: 119,539,727 I244N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Tnpo3 A C 6: 29,579,619 N258K probably benign Het
Uba6 T C 5: 86,124,370 D789G possibly damaging Het
Vmn1r226 T G 17: 20,687,730 L75V probably benign Het
Zfp729b A C 13: 67,591,701 V815G possibly damaging Het
Other mutations in Miga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Miga2 APN 2 30367717 missense probably benign 0.04
IGL01353:Miga2 APN 2 30371233 critical splice donor site probably null
IGL01679:Miga2 APN 2 30378250 missense probably benign 0.07
IGL03113:Miga2 APN 2 30384010 missense possibly damaging 0.96
uncertain UTSW 2 30371196 missense probably benign 0.00
R0620:Miga2 UTSW 2 30381744 unclassified probably benign
R1698:Miga2 UTSW 2 30377997 missense probably damaging 1.00
R1729:Miga2 UTSW 2 30368968 missense probably damaging 1.00
R1994:Miga2 UTSW 2 30381988 missense probably damaging 1.00
R2891:Miga2 UTSW 2 30378294 splice site probably null
R2892:Miga2 UTSW 2 30378294 splice site probably null
R2893:Miga2 UTSW 2 30378294 splice site probably null
R3788:Miga2 UTSW 2 30371225 nonsense probably null
R4042:Miga2 UTSW 2 30367726 missense possibly damaging 0.87
R5214:Miga2 UTSW 2 30371196 missense probably benign 0.00
R5750:Miga2 UTSW 2 30371565 missense probably damaging 1.00
R5928:Miga2 UTSW 2 30368863 splice site probably benign
R6134:Miga2 UTSW 2 30371217 missense probably benign 0.00
R6209:Miga2 UTSW 2 30381662 missense probably damaging 1.00
R6860:Miga2 UTSW 2 30371163 missense probably benign 0.15
R7373:Miga2 UTSW 2 30382071 missense probably damaging 1.00
R7884:Miga2 UTSW 2 30371204 missense probably benign 0.02
R8370:Miga2 UTSW 2 30375743 frame shift probably null
R8371:Miga2 UTSW 2 30375743 frame shift probably null
R8374:Miga2 UTSW 2 30375743 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGTTGCTTAAGGCTGGGAGAG -3'
(R):5'- AAGGGAGTGGCAGCTTTCTC -3'

Sequencing Primer
(F):5'- CTTAAGGCTGGGAGAGTGGGC -3'
(R):5'- TTGTATCTGAGGCCCAAACAG -3'
Posted On2014-11-11