Incidental Mutation 'R2377:Sla2'
ID248306
Institutional Source Beutler Lab
Gene Symbol Sla2
Ensembl Gene ENSMUSG00000027636
Gene NameSrc-like-adaptor 2
SynonymsSLAP-2, A930009E21Rik, SLAP2
MMRRC Submission 040354-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2377 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156872457-156887192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156875942 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 137 (R137C)
Ref Sequence ENSEMBL: ENSMUSP00000105189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029164] [ENSMUST00000029165] [ENSMUST00000109561]
Predicted Effect probably damaging
Transcript: ENSMUST00000029164
AA Change: R137C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029164
Gene: ENSMUSG00000027636
AA Change: R137C

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029165
SMART Domains Protein: ENSMUSP00000029165
Gene: ENSMUSG00000027637

DomainStartEndE-ValueType
Pfam:Rab5ip 44 123 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109561
AA Change: R137C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105189
Gene: ENSMUSG00000027636
AA Change: R137C

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152551
Meta Mutation Damage Score 0.3138 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLAP family of adapter proteins. The encoded protein may play an important receptor-proximal role in downregulating T and B cell-mediated responses and inhibits antigen receptor-induced calcium mobilization. This protein interacts with Cas-Br-M (murine) ecotropic retroviral transforming sequence c. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,467,923 D1304G probably damaging Het
Adamts10 C A 17: 33,528,892 H101N probably damaging Het
Apaf1 T A 10: 91,079,893 K44N possibly damaging Het
Aqr A T 2: 114,140,940 N471K possibly damaging Het
Blvrb T A 7: 27,459,599 I94N probably damaging Het
Ccdc38 C T 10: 93,574,035 P239S probably damaging Het
Chst4 T A 8: 110,030,172 Y270F possibly damaging Het
Col5a1 T C 2: 27,928,177 F138S unknown Het
Dhx32 G T 7: 133,724,478 H407N probably damaging Het
Dock3 G A 9: 106,895,891 P388S probably damaging Het
Fbxo10 A C 4: 45,044,719 Y639D probably benign Het
Fsip2 A G 2: 82,976,249 T971A probably benign Het
Gli2 C T 1: 118,837,125 A1099T possibly damaging Het
Hr C T 14: 70,557,878 L317F probably damaging Het
Ice1 G A 13: 70,602,780 A1729V probably damaging Het
Mcc C G 18: 44,519,549 K269N probably damaging Het
Miga2 T A 2: 30,383,990 C83* probably null Het
Msl1 A G 11: 98,803,963 R273G probably damaging Het
Msl3l2 T C 10: 56,115,563 I128T probably damaging Het
Ntrk1 T A 3: 87,791,407 D109V possibly damaging Het
Olfr126 A G 17: 37,850,607 N5S probably damaging Het
Olfr1307 A T 2: 111,944,643 L271Q probably damaging Het
Olfr142 A G 2: 90,252,911 F26L probably damaging Het
Olfr1447 T A 19: 12,900,853 Y309F possibly damaging Het
Pcmtd2 A G 2: 181,855,279 probably benign Het
Polr1a T C 6: 71,972,826 probably null Het
Ptk2b T A 14: 66,172,548 I452F possibly damaging Het
Rad21 A G 15: 51,968,438 F416L probably damaging Het
Scn5a A T 9: 119,539,727 I244N probably damaging Het
Tnpo3 A C 6: 29,579,619 N258K probably benign Het
Uba6 T C 5: 86,124,370 D789G possibly damaging Het
Vmn1r226 T G 17: 20,687,730 L75V probably benign Het
Zfp729b A C 13: 67,591,701 V815G possibly damaging Het
Other mutations in Sla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0992:Sla2 UTSW 2 156874472 missense probably damaging 0.99
R2250:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2257:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2378:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2379:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2442:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2443:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2843:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3416:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3417:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3499:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3792:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3793:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3878:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R5664:Sla2 UTSW 2 156874999 missense probably benign 0.04
R6784:Sla2 UTSW 2 156883669 missense unknown
R7356:Sla2 UTSW 2 156878703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAACTGACTATCTCCTAGGCCC -3'
(R):5'- ACAGCCGATATTTAATGCTCACC -3'

Sequencing Primer
(F):5'- CCTCATCCAGTCTGCAGTGG -3'
(R):5'- TAATGCTCACCCATCCTGAGG -3'
Posted On2014-11-11