Incidental Mutation 'R2377:Rad21'
ID 248328
Institutional Source Beutler Lab
Gene Symbol Rad21
Ensembl Gene ENSMUSG00000022314
Gene Name RAD21 cohesin complex component
Synonyms SCC1
MMRRC Submission 040354-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2377 (G1)
Quality Score 217
Status Not validated
Chromosome 15
Chromosomal Location 51825636-51855143 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51831834 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 416 (F416L)
Ref Sequence ENSEMBL: ENSMUSP00000022927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022927]
AlphaFold Q61550
Predicted Effect probably damaging
Transcript: ENSMUST00000022927
AA Change: F416L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022927
Gene: ENSMUSG00000022314
AA Change: F416L

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 107 6.6e-43 PFAM
low complexity region 267 283 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 521 547 N/A INTRINSIC
Pfam:Rad21_Rec8 578 632 2.4e-25 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad21, a gene involved in the repair of DNA double-strand breaks, as well as in chromatid cohesion during mitosis. This protein is a nuclear phospho-protein, which becomes hyperphosphorylated in cell cycle M phase. The highly regulated association of this protein with mitotic chromatin specifically at the centromere region suggests its role in sister chromatid cohesion in mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality, reduced male fertility, and produce oocytes that fail to maintain sister chromatids in the first mitosis following fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,285,787 (GRCm39) D1304G probably damaging Het
Adamts10 C A 17: 33,747,866 (GRCm39) H101N probably damaging Het
Apaf1 T A 10: 90,915,755 (GRCm39) K44N possibly damaging Het
Aqr A T 2: 113,971,421 (GRCm39) N471K possibly damaging Het
Blvrb T A 7: 27,159,024 (GRCm39) I94N probably damaging Het
Ccdc38 C T 10: 93,409,897 (GRCm39) P239S probably damaging Het
Chst4 T A 8: 110,756,804 (GRCm39) Y270F possibly damaging Het
Col5a1 T C 2: 27,818,189 (GRCm39) F138S unknown Het
Dhx32 G T 7: 133,326,207 (GRCm39) H407N probably damaging Het
Dock3 G A 9: 106,773,090 (GRCm39) P388S probably damaging Het
Fbxo10 A C 4: 45,044,719 (GRCm39) Y639D probably benign Het
Fsip2 A G 2: 82,806,593 (GRCm39) T971A probably benign Het
Gli2 C T 1: 118,764,855 (GRCm39) A1099T possibly damaging Het
Hr C T 14: 70,795,318 (GRCm39) L317F probably damaging Het
Ice1 G A 13: 70,750,899 (GRCm39) A1729V probably damaging Het
Mcc C G 18: 44,652,616 (GRCm39) K269N probably damaging Het
Miga2 T A 2: 30,274,002 (GRCm39) C83* probably null Het
Msl1 A G 11: 98,694,789 (GRCm39) R273G probably damaging Het
Msl3l2 T C 10: 55,991,659 (GRCm39) I128T probably damaging Het
Ntrk1 T A 3: 87,698,714 (GRCm39) D109V possibly damaging Het
Or14j5 A G 17: 38,161,498 (GRCm39) N5S probably damaging Het
Or4b13 A G 2: 90,083,255 (GRCm39) F26L probably damaging Het
Or4f14b A T 2: 111,774,988 (GRCm39) L271Q probably damaging Het
Or5b97 T A 19: 12,878,217 (GRCm39) Y309F possibly damaging Het
Pcmtd2 A G 2: 181,497,072 (GRCm39) probably benign Het
Polr1a T C 6: 71,949,810 (GRCm39) probably null Het
Ptk2b T A 14: 66,409,997 (GRCm39) I452F possibly damaging Het
Scn5a A T 9: 119,368,793 (GRCm39) I244N probably damaging Het
Sla2 G A 2: 156,717,862 (GRCm39) R137C probably damaging Het
Tnpo3 A C 6: 29,579,618 (GRCm39) N258K probably benign Het
Uba6 T C 5: 86,272,229 (GRCm39) D789G possibly damaging Het
Vmn1r226 T G 17: 20,907,992 (GRCm39) L75V probably benign Het
Zfp729b A C 13: 67,739,820 (GRCm39) V815G possibly damaging Het
Other mutations in Rad21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Rad21 APN 15 51,839,521 (GRCm39) missense possibly damaging 0.76
IGL01328:Rad21 APN 15 51,836,520 (GRCm39) missense probably damaging 1.00
PIT4449001:Rad21 UTSW 15 51,836,639 (GRCm39) missense probably benign 0.25
R0119:Rad21 UTSW 15 51,828,426 (GRCm39) missense probably benign 0.01
R0299:Rad21 UTSW 15 51,828,426 (GRCm39) missense probably benign 0.01
R0385:Rad21 UTSW 15 51,837,259 (GRCm39) missense possibly damaging 0.70
R0440:Rad21 UTSW 15 51,831,754 (GRCm39) missense probably benign 0.24
R1216:Rad21 UTSW 15 51,833,532 (GRCm39) missense possibly damaging 0.70
R1631:Rad21 UTSW 15 51,833,436 (GRCm39) missense probably damaging 1.00
R1763:Rad21 UTSW 15 51,841,566 (GRCm39) missense probably damaging 1.00
R1769:Rad21 UTSW 15 51,835,703 (GRCm39) missense probably benign
R2761:Rad21 UTSW 15 51,846,039 (GRCm39) missense probably damaging 1.00
R3116:Rad21 UTSW 15 51,828,397 (GRCm39) missense probably null 1.00
R3853:Rad21 UTSW 15 51,835,712 (GRCm39) missense probably benign
R3875:Rad21 UTSW 15 51,833,361 (GRCm39) missense probably damaging 0.99
R4618:Rad21 UTSW 15 51,833,420 (GRCm39) missense probably damaging 1.00
R4856:Rad21 UTSW 15 51,831,896 (GRCm39) missense probably damaging 1.00
R4886:Rad21 UTSW 15 51,831,896 (GRCm39) missense probably damaging 1.00
R5022:Rad21 UTSW 15 51,830,102 (GRCm39) missense probably benign 0.02
R5057:Rad21 UTSW 15 51,830,102 (GRCm39) missense probably benign 0.02
R7288:Rad21 UTSW 15 51,845,976 (GRCm39) missense possibly damaging 0.94
R7840:Rad21 UTSW 15 51,836,538 (GRCm39) missense probably damaging 1.00
R7980:Rad21 UTSW 15 51,828,422 (GRCm39) missense probably benign 0.07
R8033:Rad21 UTSW 15 51,827,628 (GRCm39) missense probably damaging 1.00
R8770:Rad21 UTSW 15 51,831,749 (GRCm39) missense probably benign 0.00
R9176:Rad21 UTSW 15 51,841,455 (GRCm39) missense probably damaging 0.99
Z1088:Rad21 UTSW 15 51,846,022 (GRCm39) missense probably damaging 0.97
Z1177:Rad21 UTSW 15 51,841,454 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATCCATGCACTTCCATGCC -3'
(R):5'- TTAGTGCTTAGGAACTGAACTGC -3'

Sequencing Primer
(F):5'- TGCACTTCCATGCCTCCAAAC -3'
(R):5'- TGAACTGCAGCGTTCCTCG -3'
Posted On 2014-11-11