Incidental Mutation 'R2377:Abcc1'
ID248329
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 1
SynonymsMrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission 040354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2377 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location14361558-14475737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14467923 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1304 (D1304G)
Ref Sequence ENSEMBL: ENSMUSP00000097743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000147759]
Predicted Effect probably damaging
Transcript: ENSMUST00000100167
AA Change: D1304G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: D1304G

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130671
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133454
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146032
Predicted Effect probably benign
Transcript: ENSMUST00000147759
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 C A 17: 33,528,892 H101N probably damaging Het
Apaf1 T A 10: 91,079,893 K44N possibly damaging Het
Aqr A T 2: 114,140,940 N471K possibly damaging Het
Blvrb T A 7: 27,459,599 I94N probably damaging Het
Ccdc38 C T 10: 93,574,035 P239S probably damaging Het
Chst4 T A 8: 110,030,172 Y270F possibly damaging Het
Col5a1 T C 2: 27,928,177 F138S unknown Het
Dhx32 G T 7: 133,724,478 H407N probably damaging Het
Dock3 G A 9: 106,895,891 P388S probably damaging Het
Fbxo10 A C 4: 45,044,719 Y639D probably benign Het
Fsip2 A G 2: 82,976,249 T971A probably benign Het
Gli2 C T 1: 118,837,125 A1099T possibly damaging Het
Hr C T 14: 70,557,878 L317F probably damaging Het
Ice1 G A 13: 70,602,780 A1729V probably damaging Het
Mcc C G 18: 44,519,549 K269N probably damaging Het
Miga2 T A 2: 30,383,990 C83* probably null Het
Msl1 A G 11: 98,803,963 R273G probably damaging Het
Msl3l2 T C 10: 56,115,563 I128T probably damaging Het
Ntrk1 T A 3: 87,791,407 D109V possibly damaging Het
Olfr126 A G 17: 37,850,607 N5S probably damaging Het
Olfr1307 A T 2: 111,944,643 L271Q probably damaging Het
Olfr142 A G 2: 90,252,911 F26L probably damaging Het
Olfr1447 T A 19: 12,900,853 Y309F possibly damaging Het
Pcmtd2 A G 2: 181,855,279 probably benign Het
Polr1a T C 6: 71,972,826 probably null Het
Ptk2b T A 14: 66,172,548 I452F possibly damaging Het
Rad21 A G 15: 51,968,438 F416L probably damaging Het
Scn5a A T 9: 119,539,727 I244N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Tnpo3 A C 6: 29,579,619 N258K probably benign Het
Uba6 T C 5: 86,124,370 D789G possibly damaging Het
Vmn1r226 T G 17: 20,687,730 L75V probably benign Het
Zfp729b A C 13: 67,591,701 V815G possibly damaging Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14460983 missense probably benign 0.34
IGL00094:Abcc1 APN 16 14470534 missense probably null 0.00
IGL00475:Abcc1 APN 16 14436573 missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14413312 nonsense probably null
IGL00765:Abcc1 APN 16 14411508 missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14410926 missense probably benign 0.18
IGL01678:Abcc1 APN 16 14405019 missense probably null 0.96
IGL01683:Abcc1 APN 16 14396424 missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14410795 missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14411519 missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14396351 missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14467979 splice site probably benign
IGL02431:Abcc1 APN 16 14419734 missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14404005 missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14466126 missense probably benign 0.00
IGL02902:Abcc1 APN 16 14423127 missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14389868 missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14457947 missense probably benign
IGL03308:Abcc1 APN 16 14470611 missense possibly damaging 0.55
PIT4544001:Abcc1 UTSW 16 14405079 missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14410927 missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14389880 missense probably benign 0.05
R0894:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14389985 critical splice donor site probably null
R1367:Abcc1 UTSW 16 14443386 missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14448434 missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14413368 missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14423117 missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14445449 missense probably benign 0.02
R1959:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14461204 missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14472068 missense probably damaging 1.00
R2513:Abcc1 UTSW 16 14473009 splice site probably null
R2876:Abcc1 UTSW 16 14457960 missense probably benign
R3003:Abcc1 UTSW 16 14436529 missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14396399 missense probably benign 0.00
R4119:Abcc1 UTSW 16 14394013 missense probably benign 0.43
R4191:Abcc1 UTSW 16 14389864 missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14460993 missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14445300 missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14394031 missense probably benign 0.00
R4779:Abcc1 UTSW 16 14410771 missense probably benign 0.35
R5027:Abcc1 UTSW 16 14404053 critical splice donor site probably null
R5275:Abcc1 UTSW 16 14466186 missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14461132 missense probably benign 0.02
R5490:Abcc1 UTSW 16 14410917 missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14460978 missense probably benign 0.18
R5641:Abcc1 UTSW 16 14472013 missense probably benign 0.00
R5642:Abcc1 UTSW 16 14443455 missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14467037 missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14465142 missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14460916 missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14465056 missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14447490 missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14411616 missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14413383 critical splice donor site probably null
R7115:Abcc1 UTSW 16 14437725 missense probably benign 0.11
R7187:Abcc1 UTSW 16 14466997 missense probably benign
R7298:Abcc1 UTSW 16 14396472 missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14465169 missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14472986 missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14389899 nonsense probably null
R7583:Abcc1 UTSW 16 14404038 missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14445419 missense probably damaging 0.96
R7971:Abcc1 UTSW 16 14448579 missense probably benign
R8048:Abcc1 UTSW 16 14410844 missense probably damaging 1.00
R8138:Abcc1 UTSW 16 14472887 missense probably damaging 0.99
R8159:Abcc1 UTSW 16 14472930 missense probably damaging 0.96
R8319:Abcc1 UTSW 16 14396451 missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14459902 missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14410809 missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14411493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTCTTGTTATGGGGAATTAAAC -3'
(R):5'- GTGAACAGCTTAAGGGGATTCATG -3'

Sequencing Primer
(F):5'- TCAGTGGGTAAATGTCTGAGGAC -3'
(R):5'- CAGCTTAAGGGGATTCATGATAGACC -3'
Posted On2014-11-11