Incidental Mutation 'R2377:Olfr1447'
ID248334
Institutional Source Beutler Lab
Gene Symbol Olfr1447
Ensembl Gene ENSMUSG00000060303
Gene Nameolfactory receptor 1447
SynonymsGA_x6K02T2RE5P-3231251-3230331, MOR202-3
MMRRC Submission 040354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2377 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12899434-12903743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12900853 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 309 (Y309F)
Ref Sequence ENSEMBL: ENSMUSP00000149392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071484] [ENSMUST00000208343] [ENSMUST00000216989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071484
AA Change: Y309F

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071419
Gene: ENSMUSG00000060303
AA Change: Y309F

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 5.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 306 2.1e-7 PFAM
Pfam:7tm_1 42 291 7.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208343
Predicted Effect possibly damaging
Transcript: ENSMUST00000216989
AA Change: Y309F

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220222
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,467,923 D1304G probably damaging Het
Adamts10 C A 17: 33,528,892 H101N probably damaging Het
Apaf1 T A 10: 91,079,893 K44N possibly damaging Het
Aqr A T 2: 114,140,940 N471K possibly damaging Het
Blvrb T A 7: 27,459,599 I94N probably damaging Het
Ccdc38 C T 10: 93,574,035 P239S probably damaging Het
Chst4 T A 8: 110,030,172 Y270F possibly damaging Het
Col5a1 T C 2: 27,928,177 F138S unknown Het
Dhx32 G T 7: 133,724,478 H407N probably damaging Het
Dock3 G A 9: 106,895,891 P388S probably damaging Het
Fbxo10 A C 4: 45,044,719 Y639D probably benign Het
Fsip2 A G 2: 82,976,249 T971A probably benign Het
Gli2 C T 1: 118,837,125 A1099T possibly damaging Het
Hr C T 14: 70,557,878 L317F probably damaging Het
Ice1 G A 13: 70,602,780 A1729V probably damaging Het
Mcc C G 18: 44,519,549 K269N probably damaging Het
Miga2 T A 2: 30,383,990 C83* probably null Het
Msl1 A G 11: 98,803,963 R273G probably damaging Het
Msl3l2 T C 10: 56,115,563 I128T probably damaging Het
Ntrk1 T A 3: 87,791,407 D109V possibly damaging Het
Olfr126 A G 17: 37,850,607 N5S probably damaging Het
Olfr1307 A T 2: 111,944,643 L271Q probably damaging Het
Olfr142 A G 2: 90,252,911 F26L probably damaging Het
Pcmtd2 A G 2: 181,855,279 probably benign Het
Polr1a T C 6: 71,972,826 probably null Het
Ptk2b T A 14: 66,172,548 I452F possibly damaging Het
Rad21 A G 15: 51,968,438 F416L probably damaging Het
Scn5a A T 9: 119,539,727 I244N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Tnpo3 A C 6: 29,579,619 N258K probably benign Het
Uba6 T C 5: 86,124,370 D789G possibly damaging Het
Vmn1r226 T G 17: 20,687,730 L75V probably benign Het
Zfp729b A C 13: 67,591,701 V815G possibly damaging Het
Other mutations in Olfr1447
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Olfr1447 APN 19 12901355 missense probably benign 0.40
IGL01704:Olfr1447 APN 19 12901739 missense probably benign 0.01
IGL01767:Olfr1447 APN 19 12901748 missense probably benign 0.12
IGL01969:Olfr1447 APN 19 12901052 missense possibly damaging 0.69
IGL02435:Olfr1447 APN 19 12901027 missense probably damaging 1.00
IGL02666:Olfr1447 APN 19 12900857 missense probably benign
IGL03034:Olfr1447 APN 19 12901757 missense possibly damaging 0.94
IGL03221:Olfr1447 APN 19 12901541 missense probably damaging 1.00
R0315:Olfr1447 UTSW 19 12901234 missense possibly damaging 0.66
R0550:Olfr1447 UTSW 19 12901800 splice site probably null
R0729:Olfr1447 UTSW 19 12900895 missense probably damaging 0.97
R1381:Olfr1447 UTSW 19 12900956 missense probably benign 0.00
R1669:Olfr1447 UTSW 19 12901288 missense possibly damaging 0.79
R1775:Olfr1447 UTSW 19 12901235 missense probably benign 0.02
R1918:Olfr1447 UTSW 19 12900851 makesense probably null
R2406:Olfr1447 UTSW 19 12901627 missense probably benign 0.11
R2471:Olfr1447 UTSW 19 12901315 missense probably benign 0.00
R2484:Olfr1447 UTSW 19 12901641 missense probably benign 0.06
R2656:Olfr1447 UTSW 19 12901666 missense probably benign 0.37
R3888:Olfr1447 UTSW 19 12901133 missense probably benign 0.00
R4250:Olfr1447 UTSW 19 12901004 missense probably benign 0.09
R4545:Olfr1447 UTSW 19 12901268 nonsense probably null
R4895:Olfr1447 UTSW 19 12900887 missense probably damaging 1.00
R4956:Olfr1447 UTSW 19 12901599 missense probably damaging 0.99
R4991:Olfr1447 UTSW 19 12901451 missense probably damaging 0.98
R5044:Olfr1447 UTSW 19 12901001 missense probably damaging 1.00
R5165:Olfr1447 UTSW 19 12901200 missense probably benign 0.00
R6025:Olfr1447 UTSW 19 12901670 missense probably benign 0.10
R6135:Olfr1447 UTSW 19 12901439 missense probably damaging 0.97
R6459:Olfr1447 UTSW 19 12901005 missense possibly damaging 0.94
R6733:Olfr1447 UTSW 19 12901241 missense probably damaging 1.00
R6789:Olfr1447 UTSW 19 12901289 missense probably benign 0.21
R6923:Olfr1447 UTSW 19 12901312 missense probably benign 0.04
R7310:Olfr1447 UTSW 19 12901273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAACACCTTCATGCATTTCTCTG -3'
(R):5'- AGGCTATATCCACCTGTGCC -3'

Sequencing Primer
(F):5'- TCATGCATTTCTCTGTTCATGG -3'
(R):5'- CACTGCAGTGTCCATTTTCTATGG -3'
Posted On2014-11-11