Mutagenetix > Incidental Mutations

Incidental Mutation 'R2378:Tpp2'

248336

Institutional Source

Beutler Lab

Gene Symbol

Tpp2

Ensembl Gene

ENSMUSG00000041763

Gene Name

tripeptidyl peptidase II

Synonyms

TppII

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.630) question?

Stock #

R2378 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43933647-44003000 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43999765 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 223 (E223V)

Ref Sequence

ENSEMBL: ENSMUSP00000140313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188313] [ENSMUST00000190207]

Predicted Effect

probably benign
Transcript: ENSMUST00000087933
AA Change: E1170V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: E1170V

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	35	500	1.4e-96	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	777	964	2.4e-80	PFAM
low complexity region	1017	1033	N/A	INTRINSIC
PDB:3LXU\|X	1034	1262	1e-20	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187115

Predicted Effect

probably benign
Transcript: ENSMUST00000188313
AA Change: E1157V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: E1157V

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	5.1e-83	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	966	2.7e-93	PFAM
low complexity region	1004	1020	N/A	INTRINSIC
PDB:3LXU\|X	1021	1249	1e-20	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000190207
AA Change: E223V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140313
Gene: ENSMUSG00000041763
AA Change: E223V

Domain	Start	End	E-Value	Type
low complexity region	70	86	N/A	INTRINSIC
PDB:3LXU\|X	87	281	3e-19	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AK157302	T	C	13: 21,495,562	I86T	possibly damaging	Het
Akr1cl	A	T	1: 65,021,988	M124K	probably benign	Het
Asap2	T	C	12: 21,254,318	L745P	possibly damaging	Het
B3gnt9	G	A	8: 105,254,484	R91C	probably damaging	Het
Capg	C	T	6: 72,555,491	P13L	probably benign	Het
Eif3c	C	T	7: 126,552,325	R609H	probably damaging	Het
Ephb3	A	G	16: 21,218,243	H152R	probably benign	Het
Gbp9	T	C	5: 105,080,176	D580G	probably benign	Het
Gm884	A	G	11: 103,619,711		probably benign	Het
Iars2	A	G	1: 185,327,721	Y97H	probably damaging	Het
Ip6k2	A	G	9: 108,796,301		probably null	Het
Itih2	T	A	2: 10,094,887	D907V	probably damaging	Het
Msh4	A	G	3: 153,863,477	C732R	probably damaging	Het
Mtss1l	T	C	8: 110,738,349	F474L	probably damaging	Het
Nbeal2	T	C	9: 110,630,808	E1175G	probably damaging	Het
Pgm3	A	T	9: 86,562,667	C272S	probably damaging	Het
R3hcc1l	T	A	19: 42,563,473	I303N	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Spsb3	A	G	17: 24,886,950		probably benign	Het
Tgfbr2	G	A	9: 116,129,950	T132I	probably benign	Het
Ttn	T	A	2: 76,889,450		probably benign	Het
Vmn2r102	T	G	17: 19,694,668	L832V	probably damaging	Het

Other mutations in Tpp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Tpp2	APN	1	43983291	missense	possibly damaging	0.90
IGL01021:Tpp2	APN	1	43934187	nonsense	probably null
IGL01096:Tpp2	APN	1	43960888	missense	probably damaging	1.00
IGL01344:Tpp2	APN	1	43983262	missense	probably benign	0.04
IGL01642:Tpp2	APN	1	43954653	missense	probably damaging	1.00
IGL02719:Tpp2	APN	1	43940231	missense	probably benign	0.09
IGL02890:Tpp2	APN	1	43999690	missense	probably damaging	1.00
IGL03102:Tpp2	APN	1	43956489	missense	probably damaging	1.00
IGL03175:Tpp2	APN	1	43973511	missense	probably benign	0.35
beaver	UTSW	1	43971715	missense	probably benign	0.08
billingsly	UTSW	1	43983552	missense	probably damaging	1.00
cleaver	UTSW	1	43978508	nonsense	probably null
Eddie	UTSW	1	43968988	missense	probably damaging	1.00
June	UTSW	1	43954710	missense	probably damaging	1.00
state	UTSW	1	43978438	missense	possibly damaging	0.48
wally	UTSW	1	43992396	critical splice donor site	probably null
Ward	UTSW	1	43954736	missense	possibly damaging	0.82
BB010:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
BB020:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R0001:Tpp2	UTSW	1	43971726	missense	probably benign	0.00
R0003:Tpp2	UTSW	1	43960139	missense	possibly damaging	0.94
R0066:Tpp2	UTSW	1	43981748	missense	possibly damaging	0.56
R0110:Tpp2	UTSW	1	43999693	missense	probably damaging	1.00
R0110:Tpp2	UTSW	1	43978504	missense	probably benign	0.00
R0167:Tpp2	UTSW	1	43970488	missense	probably benign	0.01
R0441:Tpp2	UTSW	1	43990562	missense	possibly damaging	0.85
R0520:Tpp2	UTSW	1	43990530	missense	probably damaging	1.00
R0639:Tpp2	UTSW	1	43975447	missense	probably benign	0.00
R1118:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1119:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1593:Tpp2	UTSW	1	43975433	missense	probably benign	0.01
R1702:Tpp2	UTSW	1	43990548	missense	probably damaging	0.99
R1756:Tpp2	UTSW	1	43978725	splice site	probably null
R2066:Tpp2	UTSW	1	43978438	missense	possibly damaging	0.48
R2171:Tpp2	UTSW	1	43957446	missense	probably benign	0.00
R2394:Tpp2	UTSW	1	43983186	missense	possibly damaging	0.83
R2507:Tpp2	UTSW	1	44001449	missense	probably benign	0.31
R2879:Tpp2	UTSW	1	43971623	missense	probably damaging	1.00
R3436:Tpp2	UTSW	1	43940144	missense	probably damaging	0.99
R4106:Tpp2	UTSW	1	44001457	missense	possibly damaging	0.71
R4658:Tpp2	UTSW	1	43954710	missense	probably damaging	1.00
R4760:Tpp2	UTSW	1	43971715	missense	probably benign	0.08
R4963:Tpp2	UTSW	1	43992268	missense	probably damaging	1.00
R5049:Tpp2	UTSW	1	44001473	missense	possibly damaging	0.46
R5073:Tpp2	UTSW	1	43954736	missense	possibly damaging	0.82
R6010:Tpp2	UTSW	1	43951213	critical splice donor site	probably null
R6118:Tpp2	UTSW	1	43940146	missense	probably damaging	1.00
R6155:Tpp2	UTSW	1	43956489	missense	probably damaging	1.00
R6169:Tpp2	UTSW	1	43983579	missense	probably damaging	0.99
R6236:Tpp2	UTSW	1	43977317	missense	probably benign	0.01
R6695:Tpp2	UTSW	1	43983276	missense	probably benign
R6845:Tpp2	UTSW	1	43978508	nonsense	probably null
R7054:Tpp2	UTSW	1	43983158	missense	probably damaging	1.00
R7094:Tpp2	UTSW	1	43968988	missense	probably damaging	1.00
R7223:Tpp2	UTSW	1	43968888	missense	probably damaging	1.00
R7316:Tpp2	UTSW	1	43970431	missense	probably benign	0.00
R7324:Tpp2	UTSW	1	43978778	missense	probably damaging	1.00
R7363:Tpp2	UTSW	1	43985422	missense	probably benign	0.00
R7454:Tpp2	UTSW	1	43954659	missense	probably benign	0.01
R7496:Tpp2	UTSW	1	43983517	missense	probably benign	0.09
R7699:Tpp2	UTSW	1	43970466	missense	probably benign
R7700:Tpp2	UTSW	1	43970466	missense	probably benign
R7804:Tpp2	UTSW	1	43983281	missense	probably benign	0.00
R7933:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R7979:Tpp2	UTSW	1	43940137	missense	probably benign	0.35
R8032:Tpp2	UTSW	1	43975468	missense	possibly damaging	0.82
R8101:Tpp2	UTSW	1	43970440	missense	probably damaging	1.00
R8245:Tpp2	UTSW	1	43983552	missense	probably damaging	1.00
R8314:Tpp2	UTSW	1	43934227	missense	probably benign	0.10
R8518:Tpp2	UTSW	1	43980385	missense	probably damaging	1.00
R8519:Tpp2	UTSW	1	43977205	critical splice acceptor site	probably null
R8529:Tpp2	UTSW	1	43983140	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTCCTTTAACCAAGTACAATTGCC -3'
(R):5'- CTGCATCTTCTTGAGAGTGGAGAC -3'

Sequencing Primer
(F):5'- ACCAAGTACAATTGCCTTAACTG -3'
(R):5'- GGAGACTCATCTTCATCCTCTTTGG -3'

Posted On

2014-11-11