Incidental Mutation 'R2378:Itih2'
ID248341
Institutional Source Beutler Lab
Gene Symbol Itih2
Ensembl Gene ENSMUSG00000037254
Gene Nameinter-alpha trypsin inhibitor, heavy chain 2
SynonymsItih-2, Intin2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location10094593-10131396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10094887 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 907 (D907V)
Ref Sequence ENSEMBL: ENSMUSP00000046530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042290] [ENSMUST00000042512]
Predicted Effect probably damaging
Transcript: ENSMUST00000042290
AA Change: D907V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046530
Gene: ENSMUSG00000037254
AA Change: D907V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VIT 60 189 4.35e-77 SMART
VWA 312 498 6.6e-32 SMART
Pfam:ITI_HC_C 740 925 1.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042512
SMART Domains Protein: ENSMUSP00000043614
Gene: ENSMUSG00000037262

DomainStartEndE-ValueType
ZnF_C2H2 26 50 2.35e1 SMART
Kin17_mid 52 178 5.41e-89 SMART
low complexity region 209 224 N/A INTRINSIC
low complexity region 242 258 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
KOW 334 361 1.97e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142773
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The inter-alpha-trypsin inhibitors (ITI) are a family of structurally related plasma serine protease inhibitors involved in extracellular matrix stabilization and in prevention of tumor metastasis. The ITI family contains multiple proteins made up of a light chain (see MIM 176870) and a variable number of heavy chains (Salier et al., 1987 [PubMed 2446322]; Himmelfarb et al., 2004 [PubMed 14744536]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in Itih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Itih2 APN 2 10110439 missense probably benign 0.00
IGL01775:Itih2 APN 2 10129286 missense probably benign 0.19
IGL02516:Itih2 APN 2 10097917 missense probably benign 0.00
IGL02698:Itih2 APN 2 10130501 missense probably damaging 1.00
IGL02747:Itih2 APN 2 10097945 missense probably benign 0.35
IGL03162:Itih2 APN 2 10126244 missense probably damaging 1.00
IGL03325:Itih2 APN 2 10106735 missense probably damaging 1.00
R0226:Itih2 UTSW 2 10115299 missense possibly damaging 0.71
R0316:Itih2 UTSW 2 10105246 missense possibly damaging 0.67
R0415:Itih2 UTSW 2 10105615 unclassified probably benign
R0612:Itih2 UTSW 2 10117394 missense probably benign 0.16
R0625:Itih2 UTSW 2 10123414 missense possibly damaging 0.49
R0766:Itih2 UTSW 2 10097924 missense probably benign 0.21
R1312:Itih2 UTSW 2 10097924 missense probably benign 0.21
R1322:Itih2 UTSW 2 10109522 missense probably damaging 1.00
R1521:Itih2 UTSW 2 10106747 missense probably damaging 1.00
R1544:Itih2 UTSW 2 10105214 missense probably benign 0.27
R1622:Itih2 UTSW 2 10102079 missense probably benign 0.00
R1649:Itih2 UTSW 2 10105735 missense probably benign 0.37
R2064:Itih2 UTSW 2 10130574 missense possibly damaging 0.83
R2893:Itih2 UTSW 2 10102197 missense possibly damaging 0.79
R3732:Itih2 UTSW 2 10105670 missense probably benign 0.00
R3732:Itih2 UTSW 2 10105670 missense probably benign 0.00
R3733:Itih2 UTSW 2 10105670 missense probably benign 0.00
R4195:Itih2 UTSW 2 10115285 missense probably damaging 1.00
R4405:Itih2 UTSW 2 10106737 nonsense probably null
R4585:Itih2 UTSW 2 10110400 missense probably benign 0.00
R4586:Itih2 UTSW 2 10110400 missense probably benign 0.00
R4610:Itih2 UTSW 2 10105160 missense probably damaging 0.96
R5311:Itih2 UTSW 2 10110535 missense probably benign 0.01
R5361:Itih2 UTSW 2 10096461 missense probably benign 0.09
R5436:Itih2 UTSW 2 10105196 missense probably benign 0.00
R5454:Itih2 UTSW 2 10097993 missense probably null 0.00
R5580:Itih2 UTSW 2 10123476 missense probably damaging 1.00
R5621:Itih2 UTSW 2 10102805 missense probably benign 0.00
R5846:Itih2 UTSW 2 10097903 missense probably benign 0.00
R6083:Itih2 UTSW 2 10108894 intron probably benign
R6190:Itih2 UTSW 2 10098507 missense probably benign 0.37
R6198:Itih2 UTSW 2 10098541 missense probably benign 0.00
R6469:Itih2 UTSW 2 10123413 missense possibly damaging 0.65
R6816:Itih2 UTSW 2 10105706 missense probably damaging 1.00
R6820:Itih2 UTSW 2 10098098 missense probably benign 0.00
R6853:Itih2 UTSW 2 10115266 missense probably damaging 1.00
R7102:Itih2 UTSW 2 10105763 missense probably benign 0.27
R7173:Itih2 UTSW 2 10105163 missense probably damaging 1.00
R7387:Itih2 UTSW 2 10130508 missense possibly damaging 0.63
R8021:Itih2 UTSW 2 10105652 missense probably benign
R8065:Itih2 UTSW 2 10123483 missense probably damaging 0.99
R8067:Itih2 UTSW 2 10123483 missense probably damaging 0.99
R8110:Itih2 UTSW 2 10097137 missense probably damaging 0.98
RF012:Itih2 UTSW 2 10117403 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TTTGAGTTGCTGAAACGGGG -3'
(R):5'- TAGGACCAACCCTAGACACTGA -3'

Sequencing Primer
(F):5'- TTGCTGAAACGGGGGAGTAACTG -3'
(R):5'- ACTGACATTTCTTTTAACTTGGCGG -3'
Posted On2014-11-11