Incidental Mutation 'R2378:Msh4'
ID248344
Institutional Source Beutler Lab
Gene Symbol Msh4
Ensembl Gene ENSMUSG00000005493
Gene NamemutS homolog 4
SynonymsmMsh4, 4930485C04Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location153857149-153906138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153863477 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 732 (C732R)
Ref Sequence ENSEMBL: ENSMUSP00000140190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]
Predicted Effect probably damaging
Transcript: ENSMUST00000005630
AA Change: C820R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: C820R

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:MutS_II 177 321 2.3e-20 PFAM
MUTSd 352 679 3.77e-37 SMART
MUTSac 695 888 1.6e-81 SMART
Blast:MUTSac 912 956 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186220
Predicted Effect probably damaging
Transcript: ENSMUST00000188338
AA Change: C732R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: C732R

DomainStartEndE-ValueType
Pfam:MutS_II 89 233 5.3e-19 PFAM
MUTSd 264 591 9.4e-40 SMART
MUTSac 607 800 4.2e-84 SMART
Blast:MUTSac 808 866 4e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189189
Predicted Effect probably damaging
Transcript: ENSMUST00000190449
AA Change: C626R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: C626R

DomainStartEndE-ValueType
Pfam:MutS_II 1 127 3.3e-15 PFAM
MUTSd 158 485 9.4e-40 SMART
MUTSac 501 694 4.2e-84 SMART
Blast:MUTSac 702 760 5e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191606
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in Msh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Msh4 APN 3 153883735 missense possibly damaging 0.88
IGL01098:Msh4 APN 3 153877982 splice site probably benign
IGL01609:Msh4 APN 3 153897397 missense probably damaging 1.00
IGL01785:Msh4 APN 3 153857507 missense probably damaging 1.00
IGL01939:Msh4 APN 3 153857589 missense probably damaging 1.00
IGL02022:Msh4 APN 3 153886956 missense probably damaging 1.00
IGL02209:Msh4 APN 3 153888862 missense probably damaging 1.00
IGL02224:Msh4 APN 3 153890185 missense possibly damaging 0.94
IGL02240:Msh4 APN 3 153873674 missense probably damaging 0.98
IGL02493:Msh4 APN 3 153877908 critical splice donor site probably null
IGL02576:Msh4 APN 3 153867746 missense probably damaging 1.00
IGL02616:Msh4 APN 3 153857523 missense probably benign
IGL02812:Msh4 APN 3 153901400 splice site probably benign
IGL02888:Msh4 APN 3 153896913 nonsense probably null
IGL02992:Msh4 APN 3 153872325 missense possibly damaging 0.79
IGL03191:Msh4 APN 3 153869608 missense probably damaging 0.97
P0021:Msh4 UTSW 3 153888818 missense probably damaging 1.00
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0368:Msh4 UTSW 3 153888825 missense probably damaging 1.00
R0377:Msh4 UTSW 3 153896890 missense probably benign 0.00
R0631:Msh4 UTSW 3 153866420 missense probably benign 0.02
R0632:Msh4 UTSW 3 153896895 missense probably damaging 1.00
R0677:Msh4 UTSW 3 153879367 missense possibly damaging 0.69
R0909:Msh4 UTSW 3 153863504 missense probably benign 0.00
R1081:Msh4 UTSW 3 153872358 missense probably benign 0.06
R1463:Msh4 UTSW 3 153857570 missense probably damaging 1.00
R1476:Msh4 UTSW 3 153863384 missense probably damaging 1.00
R1669:Msh4 UTSW 3 153876720 missense possibly damaging 0.47
R1733:Msh4 UTSW 3 153867767 missense probably damaging 1.00
R1859:Msh4 UTSW 3 153905880 missense probably benign
R2168:Msh4 UTSW 3 153867835 nonsense probably null
R2991:Msh4 UTSW 3 153905860 missense probably benign
R3025:Msh4 UTSW 3 153863491 missense probably damaging 1.00
R4604:Msh4 UTSW 3 153872283 missense probably damaging 1.00
R4757:Msh4 UTSW 3 153879387 missense probably damaging 0.99
R5205:Msh4 UTSW 3 153866412 missense probably damaging 1.00
R5285:Msh4 UTSW 3 153873713 missense probably benign 0.03
R5766:Msh4 UTSW 3 153867840 missense probably damaging 1.00
R5777:Msh4 UTSW 3 153863439 missense probably benign 0.01
R5888:Msh4 UTSW 3 153867723 critical splice donor site probably null
R7384:Msh4 UTSW 3 153888748 missense probably benign 0.23
R7408:Msh4 UTSW 3 153876745 missense probably benign 0.06
R7487:Msh4 UTSW 3 153863510 missense probably damaging 1.00
R7503:Msh4 UTSW 3 153867750 missense probably damaging 1.00
R7726:Msh4 UTSW 3 153866320 critical splice donor site probably null
R7990:Msh4 UTSW 3 153896892 missense probably damaging 1.00
R8097:Msh4 UTSW 3 153877908 critical splice donor site probably null
Z1177:Msh4 UTSW 3 153879368 missense probably benign 0.00
Z1177:Msh4 UTSW 3 153901443 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACACGCATTGTTTTGAGGTC -3'
(R):5'- AGAGTTGACACATGCACATTGG -3'

Sequencing Primer
(F):5'- GTCCCCTGGAAAGTTTGT -3'
(R):5'- GAACATGTCCATCTCTGAGATACTGG -3'
Posted On2014-11-11