Mutagenetix > Incidental Mutations

Incidental Mutation 'R2378:Msh4'

248344

Institutional Source

Beutler Lab

Gene Symbol

Msh4

Ensembl Gene

ENSMUSG00000005493

Gene Name

mutS homolog 4

Synonyms

mMsh4, 4930485C04Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R2378 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153857149-153906138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 153863477 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 732 (C732R)

Ref Sequence

ENSEMBL: ENSMUSP00000140190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005630
AA Change: C820R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: C820R

Domain	Start	End	E-Value	Type
low complexity region	91	107	N/A	INTRINSIC
Pfam:MutS_II	177	321	2.3e-20	PFAM
MUTSd	352	679	3.77e-37	SMART
MUTSac	695	888	1.6e-81	SMART
Blast:MUTSac	912	956	1e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158139

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186220

Predicted Effect

probably damaging
Transcript: ENSMUST00000188338
AA Change: C732R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: C732R

Domain	Start	End	E-Value	Type
Pfam:MutS_II	89	233	5.3e-19	PFAM
MUTSd	264	591	9.4e-40	SMART
MUTSac	607	800	4.2e-84	SMART
Blast:MUTSac	808	866	4e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189189

Predicted Effect

probably damaging
Transcript: ENSMUST00000190449
AA Change: C626R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: C626R

Domain	Start	End	E-Value	Type
Pfam:MutS_II	1	127	3.3e-15	PFAM
MUTSd	158	485	9.4e-40	SMART
MUTSac	501	694	4.2e-84	SMART
Blast:MUTSac	702	760	5e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191083

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191606

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AK157302	T	C	13: 21,495,562	I86T	possibly damaging	Het
Akr1cl	A	T	1: 65,021,988	M124K	probably benign	Het
Asap2	T	C	12: 21,254,318	L745P	possibly damaging	Het
B3gnt9	G	A	8: 105,254,484	R91C	probably damaging	Het
Capg	C	T	6: 72,555,491	P13L	probably benign	Het
Eif3c	C	T	7: 126,552,325	R609H	probably damaging	Het
Ephb3	A	G	16: 21,218,243	H152R	probably benign	Het
Gbp9	T	C	5: 105,080,176	D580G	probably benign	Het
Gm884	A	G	11: 103,619,711		probably benign	Het
Iars2	A	G	1: 185,327,721	Y97H	probably damaging	Het
Ip6k2	A	G	9: 108,796,301		probably null	Het
Itih2	T	A	2: 10,094,887	D907V	probably damaging	Het
Mtss1l	T	C	8: 110,738,349	F474L	probably damaging	Het
Nbeal2	T	C	9: 110,630,808	E1175G	probably damaging	Het
Pgm3	A	T	9: 86,562,667	C272S	probably damaging	Het
R3hcc1l	T	A	19: 42,563,473	I303N	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Spsb3	A	G	17: 24,886,950		probably benign	Het
Tgfbr2	G	A	9: 116,129,950	T132I	probably benign	Het
Tpp2	A	T	1: 43,999,765	E223V	probably damaging	Het
Ttn	T	A	2: 76,889,450		probably benign	Het
Vmn2r102	T	G	17: 19,694,668	L832V	probably damaging	Het

Other mutations in Msh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Msh4	APN	3	153883735	missense	possibly damaging	0.88
IGL01098:Msh4	APN	3	153877982	splice site	probably benign
IGL01609:Msh4	APN	3	153897397	missense	probably damaging	1.00
IGL01785:Msh4	APN	3	153857507	missense	probably damaging	1.00
IGL01939:Msh4	APN	3	153857589	missense	probably damaging	1.00
IGL02022:Msh4	APN	3	153886956	missense	probably damaging	1.00
IGL02209:Msh4	APN	3	153888862	missense	probably damaging	1.00
IGL02224:Msh4	APN	3	153890185	missense	possibly damaging	0.94
IGL02240:Msh4	APN	3	153873674	missense	probably damaging	0.98
IGL02493:Msh4	APN	3	153877908	critical splice donor site	probably null
IGL02576:Msh4	APN	3	153867746	missense	probably damaging	1.00
IGL02616:Msh4	APN	3	153857523	missense	probably benign
IGL02812:Msh4	APN	3	153901400	splice site	probably benign
IGL02888:Msh4	APN	3	153896913	nonsense	probably null
IGL02992:Msh4	APN	3	153872325	missense	possibly damaging	0.79
IGL03191:Msh4	APN	3	153869608	missense	probably damaging	0.97
P0021:Msh4	UTSW	3	153888818	missense	probably damaging	1.00
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0368:Msh4	UTSW	3	153888825	missense	probably damaging	1.00
R0377:Msh4	UTSW	3	153896890	missense	probably benign	0.00
R0631:Msh4	UTSW	3	153866420	missense	probably benign	0.02
R0632:Msh4	UTSW	3	153896895	missense	probably damaging	1.00
R0677:Msh4	UTSW	3	153879367	missense	possibly damaging	0.69
R0909:Msh4	UTSW	3	153863504	missense	probably benign	0.00
R1081:Msh4	UTSW	3	153872358	missense	probably benign	0.06
R1463:Msh4	UTSW	3	153857570	missense	probably damaging	1.00
R1476:Msh4	UTSW	3	153863384	missense	probably damaging	1.00
R1669:Msh4	UTSW	3	153876720	missense	possibly damaging	0.47
R1733:Msh4	UTSW	3	153867767	missense	probably damaging	1.00
R1859:Msh4	UTSW	3	153905880	missense	probably benign
R2168:Msh4	UTSW	3	153867835	nonsense	probably null
R2991:Msh4	UTSW	3	153905860	missense	probably benign
R3025:Msh4	UTSW	3	153863491	missense	probably damaging	1.00
R4604:Msh4	UTSW	3	153872283	missense	probably damaging	1.00
R4757:Msh4	UTSW	3	153879387	missense	probably damaging	0.99
R5205:Msh4	UTSW	3	153866412	missense	probably damaging	1.00
R5285:Msh4	UTSW	3	153873713	missense	probably benign	0.03
R5766:Msh4	UTSW	3	153867840	missense	probably damaging	1.00
R5777:Msh4	UTSW	3	153863439	missense	probably benign	0.01
R5888:Msh4	UTSW	3	153867723	critical splice donor site	probably null
R7384:Msh4	UTSW	3	153888748	missense	probably benign	0.23
R7408:Msh4	UTSW	3	153876745	missense	probably benign	0.06
R7487:Msh4	UTSW	3	153863510	missense	probably damaging	1.00
R7503:Msh4	UTSW	3	153867750	missense	probably damaging	1.00
R7726:Msh4	UTSW	3	153866320	critical splice donor site	probably null
R7990:Msh4	UTSW	3	153896892	missense	probably damaging	1.00
R8097:Msh4	UTSW	3	153877908	critical splice donor site	probably null
Z1177:Msh4	UTSW	3	153879368	missense	probably benign	0.00
Z1177:Msh4	UTSW	3	153901443	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ACACGCATTGTTTTGAGGTC -3'
(R):5'- AGAGTTGACACATGCACATTGG -3'

Sequencing Primer
(F):5'- GTCCCCTGGAAAGTTTGT -3'
(R):5'- GAACATGTCCATCTCTGAGATACTGG -3'

Posted On

2014-11-11