Incidental Mutation 'R2378:B3gnt9'
ID248349
Institutional Source Beutler Lab
Gene Symbol B3gnt9
Ensembl Gene ENSMUSG00000069920
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105252638-105255153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105254484 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 91 (R91C)
Ref Sequence ENSEMBL: ENSMUSP00000125145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034359] [ENSMUST00000034361] [ENSMUST00000093217] [ENSMUST00000124113] [ENSMUST00000136822] [ENSMUST00000141957] [ENSMUST00000144762] [ENSMUST00000161745]
Predicted Effect probably benign
Transcript: ENSMUST00000034359
SMART Domains Protein: ENSMUSP00000034359
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
Pfam:TRADD_N 51 161 2.9e-49 PFAM
DEATH 203 303 1.14e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034361
SMART Domains Protein: ENSMUSP00000034361
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 15 407 1.7e-161 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093217
AA Change: R91C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133023
Gene: ENSMUSG00000069920
AA Change: R91C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Pfam:Galactosyl_T 132 331 1e-40 PFAM
Pfam:Fringe 212 335 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124113
SMART Domains Protein: ENSMUSP00000119743
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 120 1.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136239
Predicted Effect probably damaging
Transcript: ENSMUST00000136822
AA Change: R91C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130840
Gene: ENSMUSG00000069920
AA Change: R91C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Pfam:Galactosyl_T 132 331 1e-40 PFAM
Pfam:Fringe 212 335 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141957
SMART Domains Protein: ENSMUSP00000119148
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 161 2.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144762
SMART Domains Protein: ENSMUSP00000119174
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
PDB:1F2H|A 1 50 7e-23 PDB
SCOP:d1f3va_ 8 50 4e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156561
Predicted Effect probably damaging
Transcript: ENSMUST00000161745
AA Change: R91C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125145
Gene: ENSMUSG00000069920
AA Change: R91C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in B3gnt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0687:B3gnt9 UTSW 8 105254783 start gained probably benign
R1342:B3gnt9 UTSW 8 105254324 missense probably null 1.00
R4622:B3gnt9 UTSW 8 105253845 missense probably benign 0.04
R4931:B3gnt9 UTSW 8 105254244 missense probably benign
R5007:B3gnt9 UTSW 8 105254490 missense probably damaging 1.00
R6052:B3gnt9 UTSW 8 105254598 missense probably benign
R6440:B3gnt9 UTSW 8 105253899 splice site probably null
R7159:B3gnt9 UTSW 8 105254432 missense probably damaging 1.00
R7558:B3gnt9 UTSW 8 105254672 missense probably benign 0.23
R8341:B3gnt9 UTSW 8 105253865 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGCATAAGCTCGGCTCTC -3'
(R):5'- ACTTTGGCATCCTTTCTGGG -3'

Sequencing Primer
(F):5'- AGAACACTCGGCGCACG -3'
(R):5'- AGAAGCTGAACTTTTTGTCCCTTAGG -3'
Posted On2014-11-11