Incidental Mutation 'R2378:Mtss1l'
ID248350
Institutional Source Beutler Lab
Gene Symbol Mtss1l
Ensembl Gene ENSMUSG00000033763
Gene Namemetastasis suppressor 1-like
SynonymsABBA
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110721476-110741400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110738349 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 474 (F474L)
Ref Sequence ENSEMBL: ENSMUSP00000050211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052457] [ENSMUST00000076846] [ENSMUST00000144041] [ENSMUST00000150680]
Predicted Effect probably damaging
Transcript: ENSMUST00000052457
AA Change: F474L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050211
Gene: ENSMUSG00000033763
AA Change: F474L

DomainStartEndE-ValueType
Pfam:IMD 15 236 8.1e-108 PFAM
low complexity region 252 274 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 312 330 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
low complexity region 668 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076846
SMART Domains Protein: ENSMUSP00000076120
Gene: ENSMUSG00000031750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:IL34 28 184 2e-79 PFAM
low complexity region 219 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133848
Predicted Effect probably benign
Transcript: ENSMUST00000141302
SMART Domains Protein: ENSMUSP00000116518
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 122 1e-56 PFAM
low complexity region 138 179 N/A INTRINSIC
low complexity region 202 213 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 286 304 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144041
AA Change: F412L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115220
Gene: ENSMUSG00000033763
AA Change: F412L

DomainStartEndE-ValueType
Pfam:IMD 1 174 3.6e-72 PFAM
low complexity region 190 212 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 306 324 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 606 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149273
SMART Domains Protein: ENSMUSP00000119495
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 126 2.5e-59 PFAM
low complexity region 142 183 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150680
SMART Domains Protein: ENSMUSP00000114398
Gene: ENSMUSG00000031750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:IL34 23 155 4.6e-64 PFAM
low complexity region 197 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154803
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in Mtss1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02124:Mtss1l APN 8 110737624 missense probably damaging 1.00
R0620:Mtss1l UTSW 8 110737948 missense probably damaging 0.98
R0685:Mtss1l UTSW 8 110727397 critical splice donor site probably null
R2082:Mtss1l UTSW 8 110726257 critical splice donor site probably null
R2149:Mtss1l UTSW 8 110726383 missense possibly damaging 0.58
R2266:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2267:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2269:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R3756:Mtss1l UTSW 8 110730060 missense probably damaging 1.00
R4005:Mtss1l UTSW 8 110739041 frame shift probably null
R4552:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4553:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4849:Mtss1l UTSW 8 110726243 missense possibly damaging 0.92
R5212:Mtss1l UTSW 8 110729218 missense probably damaging 1.00
R6294:Mtss1l UTSW 8 110727328 missense possibly damaging 0.89
R6336:Mtss1l UTSW 8 110732164 missense probably damaging 1.00
R7090:Mtss1l UTSW 8 110730024 missense probably damaging 1.00
R7580:Mtss1l UTSW 8 110737636 missense possibly damaging 0.95
R7581:Mtss1l UTSW 8 110726213 missense possibly damaging 0.92
R7810:Mtss1l UTSW 8 110726201 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGCTAGGCCTTCACAGCC -3'
(R):5'- TGTAGAAGACGCACTCCTCAC -3'

Sequencing Primer
(F):5'- CTTCACAGCCCCGGGAC -3'
(R):5'- TCTTCACAGGGACGATGGG -3'
Posted On2014-11-11