Incidental Mutation 'R2378:Pgm3'
ID248351
Institutional Source Beutler Lab
Gene Symbol Pgm3
Ensembl Gene ENSMUSG00000056131
Gene Namephosphoglucomutase 3
SynonymsPgm-3, GlcNAc-P mutase, 2810473H05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location86554377-86571842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86562667 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 272 (C272S)
Ref Sequence ENSEMBL: ENSMUSP00000072390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070064] [ENSMUST00000072585]
Predicted Effect probably benign
Transcript: ENSMUST00000070064
AA Change: C272S

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070871
Gene: ENSMUSG00000056131
AA Change: C272S

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 44 102 6.5e-9 PFAM
Pfam:PGM_PMM_I 96 174 4.3e-9 PFAM
Pfam:PGM_PMM_IV 443 528 8.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072585
AA Change: C272S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072390
Gene: ENSMUSG00000056131
AA Change: C272S

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 44 102 2.5e-10 PFAM
Pfam:PGM_PMM_I 95 175 3.6e-11 PFAM
Pfam:PGM_PMM_II 181 291 9.4e-14 PFAM
SCOP:d3pmga3 298 374 1e-8 SMART
Pfam:PGM_PMM_IV 383 487 8.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190924
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphohexose mutase family. The encoded protein mediates both glycogen formation and utilization by catalyzing the interconversion of glucose-1-phosphate and glucose-6-phosphate. A non-synonymous single nucleotide polymorphism in this gene may play a role in resistance to diabetic nephropathy and neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility, anemia, leukopenia, thrombocytopenia, abnormal pancreatic and salivary gland morphology, and splenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in Pgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Pgm3 APN 9 86561879 missense probably damaging 0.96
IGL01865:Pgm3 APN 9 86555318 missense possibly damaging 0.85
IGL02800:Pgm3 APN 9 86555378 missense possibly damaging 0.94
R6592_Pgm3_648 UTSW 9 86559443 missense possibly damaging 0.87
R0038:Pgm3 UTSW 9 86564673 splice site probably benign
R0038:Pgm3 UTSW 9 86564673 splice site probably benign
R0266:Pgm3 UTSW 9 86567533 missense probably benign 0.00
R0536:Pgm3 UTSW 9 86567536 missense possibly damaging 0.83
R0617:Pgm3 UTSW 9 86556190 critical splice donor site probably null
R1499:Pgm3 UTSW 9 86570287 missense probably benign 0.01
R1780:Pgm3 UTSW 9 86556204 missense probably damaging 1.00
R1838:Pgm3 UTSW 9 86569233 missense probably benign 0.03
R1882:Pgm3 UTSW 9 86565690 missense possibly damaging 0.72
R1920:Pgm3 UTSW 9 86558478 missense possibly damaging 0.47
R2095:Pgm3 UTSW 9 86556341 missense probably damaging 0.99
R2679:Pgm3 UTSW 9 86569321 missense probably benign 0.32
R3021:Pgm3 UTSW 9 86567535 missense possibly damaging 0.95
R3686:Pgm3 UTSW 9 86559510 missense probably benign 0.37
R4490:Pgm3 UTSW 9 86561840 missense probably damaging 1.00
R4651:Pgm3 UTSW 9 86558470 missense probably benign 0.01
R4652:Pgm3 UTSW 9 86558470 missense probably benign 0.01
R4718:Pgm3 UTSW 9 86570395 missense probably benign 0.00
R4883:Pgm3 UTSW 9 86569325 missense probably damaging 1.00
R4940:Pgm3 UTSW 9 86559476 missense probably damaging 1.00
R4973:Pgm3 UTSW 9 86562679 missense probably benign
R4990:Pgm3 UTSW 9 86558412 missense probably damaging 0.97
R5357:Pgm3 UTSW 9 86556257 nonsense probably null
R5870:Pgm3 UTSW 9 86570361 missense probably damaging 0.99
R6592:Pgm3 UTSW 9 86559443 missense possibly damaging 0.87
R6807:Pgm3 UTSW 9 86556502 splice site probably null
R7152:Pgm3 UTSW 9 86567540 missense probably benign 0.13
R7274:Pgm3 UTSW 9 86562597 missense probably damaging 1.00
R8112:Pgm3 UTSW 9 86564775 missense probably benign
R8195:Pgm3 UTSW 9 86570321 missense probably damaging 1.00
X0028:Pgm3 UTSW 9 86569355 missense probably damaging 1.00
Z1088:Pgm3 UTSW 9 86564707 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTTCTCAGGCCACAAAACTC -3'
(R):5'- TCTCTTGAAATAGTGGATGTCCTG -3'

Sequencing Primer
(F):5'- AGGAACTCGCTATACCCAGTGG -3'
(R):5'- GGATGTCCTGTACTGTAGCAC -3'
Posted On2014-11-11