Mutagenetix > Incidental Mutations

Incidental Mutation 'R2378:Ip6k2'

248352

Institutional Source

Beutler Lab

Gene Symbol

Ip6k2

Ensembl Gene

ENSMUSG00000032599

Gene Name

inositol hexaphosphate kinase 2

Synonyms

Ihpk2, 1500005N04Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2378 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108783796-108806337 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 108796301 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085018] [ENSMUST00000192028] [ENSMUST00000192226] [ENSMUST00000192307] [ENSMUST00000193560] [ENSMUST00000194782] [ENSMUST00000194875] [ENSMUST00000195514]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085018
AA Change: N36S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082091
Gene: ENSMUSG00000032599
AA Change: N36S

Domain	Start	End	E-Value	Type
Pfam:IPK	225	440	2.7e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158001

Predicted Effect

probably damaging
Transcript: ENSMUST00000192028
AA Change: N36S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000192226
AA Change: N36S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably damaging
Transcript: ENSMUST00000192307
AA Change: N36S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

probably null
Transcript: ENSMUST00000193055

Predicted Effect

probably damaging
Transcript: ENSMUST00000193560
AA Change: N36S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141605
Gene: ENSMUSG00000032599
AA Change: N36S

Domain	Start	End	E-Value	Type
Pfam:IPK	179	394	1.6e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193634

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193970

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194782
AA Change: N36S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000194875
AA Change: N36S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142239
Gene: ENSMUSG00000032599
AA Change: N36S

Domain	Start	End	E-Value	Type
low complexity region	72	80	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000195514
AA Change: N36S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195580

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are resistant to radiation-induced mortality and show increased double-strand DNA break repair and incidence of induced aerodigestive tract carcinomas. Homozygotes for another null allele show increased B cell viability after radiation or neocarzinostatin treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AK157302	T	C	13: 21,495,562	I86T	possibly damaging	Het
Akr1cl	A	T	1: 65,021,988	M124K	probably benign	Het
Asap2	T	C	12: 21,254,318	L745P	possibly damaging	Het
B3gnt9	G	A	8: 105,254,484	R91C	probably damaging	Het
Capg	C	T	6: 72,555,491	P13L	probably benign	Het
Eif3c	C	T	7: 126,552,325	R609H	probably damaging	Het
Ephb3	A	G	16: 21,218,243	H152R	probably benign	Het
Gbp9	T	C	5: 105,080,176	D580G	probably benign	Het
Gm884	A	G	11: 103,619,711		probably benign	Het
Iars2	A	G	1: 185,327,721	Y97H	probably damaging	Het
Itih2	T	A	2: 10,094,887	D907V	probably damaging	Het
Msh4	A	G	3: 153,863,477	C732R	probably damaging	Het
Mtss1l	T	C	8: 110,738,349	F474L	probably damaging	Het
Nbeal2	T	C	9: 110,630,808	E1175G	probably damaging	Het
Pgm3	A	T	9: 86,562,667	C272S	probably damaging	Het
R3hcc1l	T	A	19: 42,563,473	I303N	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Spsb3	A	G	17: 24,886,950		probably benign	Het
Tgfbr2	G	A	9: 116,129,950	T132I	probably benign	Het
Tpp2	A	T	1: 43,999,765	E223V	probably damaging	Het
Ttn	T	A	2: 76,889,450		probably benign	Het
Vmn2r102	T	G	17: 19,694,668	L832V	probably damaging	Het

Other mutations in Ip6k2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01100:Ip6k2	APN	9	108805744	missense	probably damaging	1.00
IGL01585:Ip6k2	APN	9	108796313	missense	probably damaging	1.00
IGL02377:Ip6k2	APN	9	108804599	missense	probably damaging	1.00
IGL02831:Ip6k2	APN	9	108804534	unclassified	probably benign
banting	UTSW	9	108805648	missense	probably benign	0.07
R0310:Ip6k2	UTSW	9	108799233	splice site	probably benign
R0541:Ip6k2	UTSW	9	108804627	missense	probably damaging	1.00
R4119:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4120:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4165:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4231:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4232:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4235:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4236:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4327:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4328:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R5019:Ip6k2	UTSW	9	108797746	intron	probably benign
R5466:Ip6k2	UTSW	9	108798462	missense	probably damaging	1.00
R6017:Ip6k2	UTSW	9	108797267	missense	probably benign	0.01
R6688:Ip6k2	UTSW	9	108806011	missense	probably benign	0.00
R6971:Ip6k2	UTSW	9	108797311	intron	probably benign
R7150:Ip6k2	UTSW	9	108796731	missense	unknown
R8007:Ip6k2	UTSW	9	108805756	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- GCTGAGATCAAACAGGTGGC -3'
(R):5'- GAGCAATCTTACCAGGGCTTG -3'

Sequencing Primer
(F):5'- TCAAACAGGTGGCTGTAAGGAC -3'
(R):5'- TCTTACCAGGGCTTGAAAATTGAGG -3'

Posted On

2014-11-11