Incidental Mutation 'R2378:Ip6k2'
ID248352
Institutional Source Beutler Lab
Gene Symbol Ip6k2
Ensembl Gene ENSMUSG00000032599
Gene Nameinositol hexaphosphate kinase 2
SynonymsIhpk2, 1500005N04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108783796-108806337 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 108796301 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000085018] [ENSMUST00000192028] [ENSMUST00000192226] [ENSMUST00000192307] [ENSMUST00000193560] [ENSMUST00000194782] [ENSMUST00000194875] [ENSMUST00000195514]
Predicted Effect probably damaging
Transcript: ENSMUST00000085018
AA Change: N36S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082091
Gene: ENSMUSG00000032599
AA Change: N36S

DomainStartEndE-ValueType
Pfam:IPK 225 440 2.7e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158001
Predicted Effect probably damaging
Transcript: ENSMUST00000192028
AA Change: N36S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000192226
AA Change: N36S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably damaging
Transcript: ENSMUST00000192307
AA Change: N36S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably null
Transcript: ENSMUST00000193055
Predicted Effect probably damaging
Transcript: ENSMUST00000193560
AA Change: N36S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141605
Gene: ENSMUSG00000032599
AA Change: N36S

DomainStartEndE-ValueType
Pfam:IPK 179 394 1.6e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193970
Predicted Effect possibly damaging
Transcript: ENSMUST00000194782
AA Change: N36S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000194875
AA Change: N36S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142239
Gene: ENSMUSG00000032599
AA Change: N36S

DomainStartEndE-ValueType
low complexity region 72 80 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195514
AA Change: N36S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195580
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are resistant to radiation-induced mortality and show increased double-strand DNA break repair and incidence of induced aerodigestive tract carcinomas. Homozygotes for another null allele show increased B cell viability after radiation or neocarzinostatin treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in Ip6k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ip6k2 APN 9 108805744 missense probably damaging 1.00
IGL01585:Ip6k2 APN 9 108796313 missense probably damaging 1.00
IGL02377:Ip6k2 APN 9 108804599 missense probably damaging 1.00
IGL02831:Ip6k2 APN 9 108804534 unclassified probably benign
banting UTSW 9 108805648 missense probably benign 0.07
R0310:Ip6k2 UTSW 9 108799233 splice site probably benign
R0541:Ip6k2 UTSW 9 108804627 missense probably damaging 1.00
R4119:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4120:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4165:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4231:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4232:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4235:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4236:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4327:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4328:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R5019:Ip6k2 UTSW 9 108797746 intron probably benign
R5466:Ip6k2 UTSW 9 108798462 missense probably damaging 1.00
R6017:Ip6k2 UTSW 9 108797267 missense probably benign 0.01
R6688:Ip6k2 UTSW 9 108806011 missense probably benign 0.00
R6971:Ip6k2 UTSW 9 108797311 intron probably benign
R7150:Ip6k2 UTSW 9 108796731 missense unknown
R8007:Ip6k2 UTSW 9 108805756 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GCTGAGATCAAACAGGTGGC -3'
(R):5'- GAGCAATCTTACCAGGGCTTG -3'

Sequencing Primer
(F):5'- TCAAACAGGTGGCTGTAAGGAC -3'
(R):5'- TCTTACCAGGGCTTGAAAATTGAGG -3'
Posted On2014-11-11