Incidental Mutation 'R2378:AK157302'
ID248360
Institutional Source Beutler Lab
Gene Symbol AK157302
Ensembl Gene ENSMUSG00000078139
Gene NamecDNA sequence AK157302
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21495223-21497146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21495562 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 86 (I86T)
Ref Sequence ENSEMBL: ENSMUSP00000100547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104942]
Predicted Effect possibly damaging
Transcript: ENSMUST00000104942
AA Change: I86T

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100547
Gene: ENSMUSG00000078139
AA Change: I86T

DomainStartEndE-ValueType
Pfam:Fe-S_biosyn 23 125 7e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in AK157302
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:AK157302 APN 13 21495301 utr 5 prime probably benign
Benjamin UTSW 13 21495663 missense possibly damaging 0.84
R0610:AK157302 UTSW 13 21495663 missense possibly damaging 0.84
R2155:AK157302 UTSW 13 21495657 nonsense probably null
R4291:AK157302 UTSW 13 21495545 missense probably damaging 1.00
R4477:AK157302 UTSW 13 21495691 missense possibly damaging 0.51
R5887:AK157302 UTSW 13 21495409 missense possibly damaging 0.95
R6608:AK157302 UTSW 13 21495624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGAGAGAAGCTGAGTCCC -3'
(R):5'- GATTTCTTCAGGAAGCGCCG -3'

Sequencing Primer
(F):5'- AAGCTGAGTCCCCACGCTC -3'
(R):5'- GAGGCAGACCCAGCTCTC -3'
Posted On2014-11-11