Incidental Mutation 'R2378:Ephb3'
ID248361
Institutional Source Beutler Lab
Gene Symbol Ephb3
Ensembl Gene ENSMUSG00000005958
Gene NameEph receptor B3
SynonymsTyro6, HEK2, MDK5, Sek4, Etk2, Cek10
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location21204755-21223305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21218243 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 152 (H152R)
Ref Sequence ENSEMBL: ENSMUSP00000124375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063] [ENSMUST00000231316] [ENSMUST00000232407]
Predicted Effect probably benign
Transcript: ENSMUST00000006112
AA Change: H406R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: H406R

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
EPH_lbd 31 204 6.47e-126 SMART
Pfam:GCC2_GCC3 269 312 5.8e-9 PFAM
FN3 332 430 8.43e-9 SMART
FN3 448 527 2.72e-12 SMART
Pfam:EphA2_TM 555 625 1e-24 PFAM
TyrKc 628 887 1.35e-134 SMART
SAM 917 984 3.88e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160053
Predicted Effect probably benign
Transcript: ENSMUST00000161063
AA Change: H152R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231316
Predicted Effect probably benign
Transcript: ENSMUST00000232407
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in Ephb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ephb3 APN 16 21220415 splice site probably null
IGL00966:Ephb3 APN 16 21217294 missense probably benign 0.00
IGL02166:Ephb3 APN 16 21220749 missense probably damaging 1.00
IGL02245:Ephb3 APN 16 21221424 missense probably benign 0.04
IGL02321:Ephb3 APN 16 21214389 missense probably damaging 1.00
IGL02337:Ephb3 APN 16 21221503 splice site probably null
IGL02507:Ephb3 APN 16 21220639 splice site probably benign
IGL02755:Ephb3 APN 16 21221698 missense probably damaging 1.00
IGL02806:Ephb3 APN 16 21222281 missense probably benign 0.02
PIT4362001:Ephb3 UTSW 16 21220857 missense probably damaging 1.00
R0026:Ephb3 UTSW 16 21214917 missense probably damaging 1.00
R0194:Ephb3 UTSW 16 21218109 missense probably benign 0.01
R0196:Ephb3 UTSW 16 21218054 missense probably damaging 1.00
R0230:Ephb3 UTSW 16 21220775 missense probably damaging 1.00
R0828:Ephb3 UTSW 16 21219034 unclassified probably benign
R1126:Ephb3 UTSW 16 21222476 missense possibly damaging 0.87
R1460:Ephb3 UTSW 16 21218922 missense probably benign
R1592:Ephb3 UTSW 16 21221700 missense probably damaging 1.00
R1632:Ephb3 UTSW 16 21212937 missense probably benign 0.00
R1694:Ephb3 UTSW 16 21221745 missense probably damaging 1.00
R1719:Ephb3 UTSW 16 21220650 missense probably damaging 1.00
R1777:Ephb3 UTSW 16 21217235 missense probably damaging 0.99
R1928:Ephb3 UTSW 16 21222295 missense possibly damaging 0.86
R1956:Ephb3 UTSW 16 21221382 missense probably damaging 1.00
R3408:Ephb3 UTSW 16 21219504 missense probably damaging 0.99
R4027:Ephb3 UTSW 16 21221697 missense probably damaging 1.00
R4429:Ephb3 UTSW 16 21214463 missense probably damaging 1.00
R4655:Ephb3 UTSW 16 21222208 missense probably damaging 0.98
R4826:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4828:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4960:Ephb3 UTSW 16 21220495 missense probably benign 0.09
R5057:Ephb3 UTSW 16 21220447 missense probably damaging 1.00
R5090:Ephb3 UTSW 16 21214487 missense probably damaging 1.00
R5396:Ephb3 UTSW 16 21219105 missense possibly damaging 0.91
R5540:Ephb3 UTSW 16 21220860 missense probably damaging 1.00
R5628:Ephb3 UTSW 16 21218119 missense probably damaging 1.00
R5666:Ephb3 UTSW 16 21222491 missense probably benign 0.08
R5838:Ephb3 UTSW 16 21221687 missense probably damaging 1.00
R5866:Ephb3 UTSW 16 21211379 intron probably benign
R6017:Ephb3 UTSW 16 21222031 missense probably damaging 1.00
R6020:Ephb3 UTSW 16 21222013 missense probably damaging 0.99
R6510:Ephb3 UTSW 16 21218111 missense probably damaging 0.98
R6539:Ephb3 UTSW 16 21221468 missense probably benign
R6591:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R6691:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R7101:Ephb3 UTSW 16 21218518 missense possibly damaging 0.86
R7111:Ephb3 UTSW 16 21218827 nonsense probably null
R7236:Ephb3 UTSW 16 21214481 missense probably damaging 1.00
R7307:Ephb3 UTSW 16 21222226 missense probably benign 0.04
R7410:Ephb3 UTSW 16 21221408 missense possibly damaging 0.75
R7413:Ephb3 UTSW 16 21214707 missense probably damaging 1.00
R7452:Ephb3 UTSW 16 21217357 splice site probably null
R7944:Ephb3 UTSW 16 21221684 missense probably damaging 1.00
R7945:Ephb3 UTSW 16 21221684 missense probably damaging 1.00
Z1176:Ephb3 UTSW 16 21218036 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GATCTCCAATGTGAATGAGACCTC -3'
(R):5'- AGTTCAGTACCCACAGGAGC -3'

Sequencing Primer
(F):5'- CTCGCTAATCCTCGAATGGAGTGAG -3'
(R):5'- CCCTCTGTATCCAGGGCAAGATG -3'
Posted On2014-11-11