Mutagenetix > Incidental Mutations

Incidental Mutation 'R2378:Ephb3'

248361

Institutional Source

Beutler Lab

Gene Symbol

Ephb3

Ensembl Gene

ENSMUSG00000005958

Gene Name

Eph receptor B3

Synonyms

Tyro6, HEK2, MDK5, Sek4, Etk2, Cek10

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R2378 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21204755-21223305 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21218243 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 152 (H152R)

Ref Sequence

ENSEMBL: ENSMUSP00000124375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063] [ENSMUST00000231316] [ENSMUST00000232407]

Predicted Effect

probably benign
Transcript: ENSMUST00000006112
AA Change: H406R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: H406R

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
EPH_lbd	31	204	6.47e-126	SMART
Pfam:GCC2_GCC3	269	312	5.8e-9	PFAM
FN3	332	430	8.43e-9	SMART
FN3	448	527	2.72e-12	SMART
Pfam:EphA2_TM	555	625	1e-24	PFAM
TyrKc	628	887	1.35e-134	SMART
SAM	917	984	3.88e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160053

Predicted Effect

probably benign
Transcript: ENSMUST00000161063
AA Change: H152R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000231316

Predicted Effect

probably benign
Transcript: ENSMUST00000232407

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AK157302	T	C	13: 21,495,562	I86T	possibly damaging	Het
Akr1cl	A	T	1: 65,021,988	M124K	probably benign	Het
Asap2	T	C	12: 21,254,318	L745P	possibly damaging	Het
B3gnt9	G	A	8: 105,254,484	R91C	probably damaging	Het
Capg	C	T	6: 72,555,491	P13L	probably benign	Het
Eif3c	C	T	7: 126,552,325	R609H	probably damaging	Het
Gbp9	T	C	5: 105,080,176	D580G	probably benign	Het
Gm884	A	G	11: 103,619,711		probably benign	Het
Iars2	A	G	1: 185,327,721	Y97H	probably damaging	Het
Ip6k2	A	G	9: 108,796,301		probably null	Het
Itih2	T	A	2: 10,094,887	D907V	probably damaging	Het
Msh4	A	G	3: 153,863,477	C732R	probably damaging	Het
Mtss1l	T	C	8: 110,738,349	F474L	probably damaging	Het
Nbeal2	T	C	9: 110,630,808	E1175G	probably damaging	Het
Pgm3	A	T	9: 86,562,667	C272S	probably damaging	Het
R3hcc1l	T	A	19: 42,563,473	I303N	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Spsb3	A	G	17: 24,886,950		probably benign	Het
Tgfbr2	G	A	9: 116,129,950	T132I	probably benign	Het
Tpp2	A	T	1: 43,999,765	E223V	probably damaging	Het
Ttn	T	A	2: 76,889,450		probably benign	Het
Vmn2r102	T	G	17: 19,694,668	L832V	probably damaging	Het

Other mutations in Ephb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Ephb3	APN	16	21220415	splice site	probably null
IGL00966:Ephb3	APN	16	21217294	missense	probably benign	0.00
IGL02166:Ephb3	APN	16	21220749	missense	probably damaging	1.00
IGL02245:Ephb3	APN	16	21221424	missense	probably benign	0.04
IGL02321:Ephb3	APN	16	21214389	missense	probably damaging	1.00
IGL02337:Ephb3	APN	16	21221503	splice site	probably null
IGL02507:Ephb3	APN	16	21220639	splice site	probably benign
IGL02755:Ephb3	APN	16	21221698	missense	probably damaging	1.00
IGL02806:Ephb3	APN	16	21222281	missense	probably benign	0.02
PIT4362001:Ephb3	UTSW	16	21220857	missense	probably damaging	1.00
R0026:Ephb3	UTSW	16	21214917	missense	probably damaging	1.00
R0194:Ephb3	UTSW	16	21218109	missense	probably benign	0.01
R0196:Ephb3	UTSW	16	21218054	missense	probably damaging	1.00
R0230:Ephb3	UTSW	16	21220775	missense	probably damaging	1.00
R0828:Ephb3	UTSW	16	21219034	unclassified	probably benign
R1126:Ephb3	UTSW	16	21222476	missense	possibly damaging	0.87
R1460:Ephb3	UTSW	16	21218922	missense	probably benign
R1592:Ephb3	UTSW	16	21221700	missense	probably damaging	1.00
R1632:Ephb3	UTSW	16	21212937	missense	probably benign	0.00
R1694:Ephb3	UTSW	16	21221745	missense	probably damaging	1.00
R1719:Ephb3	UTSW	16	21220650	missense	probably damaging	1.00
R1777:Ephb3	UTSW	16	21217235	missense	probably damaging	0.99
R1928:Ephb3	UTSW	16	21222295	missense	possibly damaging	0.86
R1956:Ephb3	UTSW	16	21221382	missense	probably damaging	1.00
R3408:Ephb3	UTSW	16	21219504	missense	probably damaging	0.99
R4027:Ephb3	UTSW	16	21221697	missense	probably damaging	1.00
R4429:Ephb3	UTSW	16	21214463	missense	probably damaging	1.00
R4655:Ephb3	UTSW	16	21222208	missense	probably damaging	0.98
R4826:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4828:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4960:Ephb3	UTSW	16	21220495	missense	probably benign	0.09
R5057:Ephb3	UTSW	16	21220447	missense	probably damaging	1.00
R5090:Ephb3	UTSW	16	21214487	missense	probably damaging	1.00
R5396:Ephb3	UTSW	16	21219105	missense	possibly damaging	0.91
R5540:Ephb3	UTSW	16	21220860	missense	probably damaging	1.00
R5628:Ephb3	UTSW	16	21218119	missense	probably damaging	1.00
R5666:Ephb3	UTSW	16	21222491	missense	probably benign	0.08
R5838:Ephb3	UTSW	16	21221687	missense	probably damaging	1.00
R5866:Ephb3	UTSW	16	21211379	intron	probably benign
R6017:Ephb3	UTSW	16	21222031	missense	probably damaging	1.00
R6020:Ephb3	UTSW	16	21222013	missense	probably damaging	0.99
R6510:Ephb3	UTSW	16	21218111	missense	probably damaging	0.98
R6539:Ephb3	UTSW	16	21221468	missense	probably benign
R6591:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R6691:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R7101:Ephb3	UTSW	16	21218518	missense	possibly damaging	0.86
R7111:Ephb3	UTSW	16	21218827	nonsense	probably null
R7236:Ephb3	UTSW	16	21214481	missense	probably damaging	1.00
R7307:Ephb3	UTSW	16	21222226	missense	probably benign	0.04
R7410:Ephb3	UTSW	16	21221408	missense	possibly damaging	0.75
R7413:Ephb3	UTSW	16	21214707	missense	probably damaging	1.00
R7452:Ephb3	UTSW	16	21217357	splice site	probably null
R7944:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R7945:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
Z1176:Ephb3	UTSW	16	21218036	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- GATCTCCAATGTGAATGAGACCTC -3'
(R):5'- AGTTCAGTACCCACAGGAGC -3'

Sequencing Primer
(F):5'- CTCGCTAATCCTCGAATGGAGTGAG -3'
(R):5'- CCCTCTGTATCCAGGGCAAGATG -3'

Posted On

2014-11-11