Incidental Mutation 'R2378:Spsb3'
ID248363
Institutional Source Beutler Lab
Gene Symbol Spsb3
Ensembl Gene ENSMUSG00000024160
Gene NamesplA/ryanodine receptor domain and SOCS box containing 3
SynonymsSSB3, Tce1, 3300001M01Rik, 2310012N15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24886643-24892152 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 24886950 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024976] [ENSMUST00000044252] [ENSMUST00000050714] [ENSMUST00000068508] [ENSMUST00000117890] [ENSMUST00000119829] [ENSMUST00000119848] [ENSMUST00000120943] [ENSMUST00000130194] [ENSMUST00000144430] [ENSMUST00000168265]
Predicted Effect probably benign
Transcript: ENSMUST00000024976
SMART Domains Protein: ENSMUSP00000024976
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Pfam:SPRY 181 304 5.7e-18 PFAM
SOCS_box 309 347 2.8e0 SMART
low complexity region 364 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044252
SMART Domains Protein: ENSMUSP00000049319
Gene: ENSMUSG00000039183

DomainStartEndE-ValueType
Pfam:ParA 16 267 3.2e-99 PFAM
Pfam:ArsA_ATPase 19 66 1.7e-8 PFAM
Pfam:AAA_31 19 79 1.5e-8 PFAM
Pfam:MipZ 19 155 2.1e-10 PFAM
Pfam:CbiA 21 199 2.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050714
SMART Domains Protein: ENSMUSP00000060169
Gene: ENSMUSG00000046070

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 40 78 9.37e-10 SMART
LRR 77 96 1.62e1 SMART
LRR 97 120 1.41e1 SMART
LRR_TYP 121 144 6.78e-3 SMART
LRR 145 168 1.03e1 SMART
LRR_TYP 169 192 1.1e-2 SMART
LRR 193 216 2.17e-1 SMART
LRR_TYP 217 240 2.4e-3 SMART
LRR_TYP 241 264 1.82e-3 SMART
LRR 265 288 5.72e-1 SMART
LRR_TYP 289 312 6.23e-2 SMART
LRR_TYP 313 336 6.32e-3 SMART
LRR_TYP 337 360 2.2e-2 SMART
LRR 361 384 1.89e-1 SMART
LRR 385 408 3.87e1 SMART
LRR 409 432 2.67e-1 SMART
LRR_TYP 433 456 1.06e-4 SMART
LRR_TYP 457 480 6.78e-3 SMART
LRR 481 504 1.09e2 SMART
LRR 505 530 2.68e1 SMART
LRRCT 535 582 5.11e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068508
SMART Domains Protein: ENSMUSP00000068567
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 252 1.3e-13 PFAM
low complexity region 295 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117890
SMART Domains Protein: ENSMUSP00000112380
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119829
SMART Domains Protein: ENSMUSP00000112589
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 294 6.9e-16 PFAM
SOCS_box 299 337 2.8e0 SMART
low complexity region 354 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119848
SMART Domains Protein: ENSMUSP00000113167
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 8.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120943
SMART Domains Protein: ENSMUSP00000112492
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130194
SMART Domains Protein: ENSMUSP00000119896
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134932
Predicted Effect probably benign
Transcript: ENSMUST00000144430
SMART Domains Protein: ENSMUSP00000117226
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168265
AA Change: S91G
SMART Domains Protein: ENSMUSP00000126878
Gene: ENSMUSG00000024160
AA Change: S91G

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
Pfam:SPRY 294 416 5.8e-20 PFAM
SOCS_box 420 458 2.8e0 SMART
low complexity region 475 484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in Spsb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Spsb3 APN 17 24890565 splice site probably benign
IGL03225:Spsb3 APN 17 24891071 missense possibly damaging 0.90
R0071:Spsb3 UTSW 17 24887904 missense probably damaging 1.00
R0071:Spsb3 UTSW 17 24887904 missense probably damaging 1.00
R0924:Spsb3 UTSW 17 24891384 missense probably damaging 0.98
R1291:Spsb3 UTSW 17 24887808 splice site probably null
R2211:Spsb3 UTSW 17 24890937 critical splice donor site probably null
R4512:Spsb3 UTSW 17 24890296 missense probably damaging 0.97
R4950:Spsb3 UTSW 17 24887511 intron probably benign
R5020:Spsb3 UTSW 17 24887062 unclassified probably benign
R5155:Spsb3 UTSW 17 24886995 unclassified probably benign
R6444:Spsb3 UTSW 17 24891576 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAAGCCTCTTGACAG -3'
(R):5'- TGTAGACCCACTGTACTACCC -3'

Sequencing Primer
(F):5'- AAGCCTCTTGACAGCAGTCCTG -3'
(R):5'- GTAGACCCACTGTACTACCCTACCTC -3'
Posted On2014-11-11